Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

... though 3 Binning is the process of dividing the entire range of a variable into smaller intervals and counting the number of observations within each bin or interval. In fixed binning, all the intervals ... ob- serve that markedness plays a very important role in shaping the global structure of the consonant in- ventories. In fact, if we arrange the conson...

Ngày tải lên: 22/02/2014, 02:20

... Toyobo (Osaka, Japan), and New England Biolabs (Beverly, MA, USA). All other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industries (Osaka, Japan). Culture ... myokinase, enolase, lactate dehydrogenase, and glutamate dehydrogenase from Oriental Yeast, Osaka, Japan. Other analytical methods The N-terminal amino-acid sequence of the enzyme...

Ngày tải lên: 19/02/2014, 16:20

... holo- metabolous insects, the basal external structure of adult appendages such as wings, legs and antennae have already been built at the time of pupation, although they are still very immature. The imaginal disks ... for wing imaginal disks in Lepidoptera. Proc Natl Acad Sci USA 99, 15446–15450. 30 Satake S, Masumura M, Ishizaki H, Nagata K, Kataoka H, Suzuki A & Mizoguchi...

Ngày tải lên: 18/02/2014, 13:20

... generation. While humor/sarcasm recognition merits direct ap- plication to the areas such as information retrieval (Friedland and Allan, 2008), sentiment classifica- tion (Mihalcea and Strapparava, ... the verbal theory of humor is an accessi- ble avenue for verifying the psycholinguistic theory. In this paper we take the Semantic Script Theory of Humor (SSTH) (Attardo and Raskin...

Ngày tải lên: 19/02/2014, 19:20

... information available to an average, idealized speaker). A Metalinguistic Information Database (MID), on the other hand, compiles the real-time data provided by metalan- guage analysis of leading-edge ... growth of their knowledge, is both feasible and practical. A good example of this NLP-based processing need is the MedLine abstract database maintained by the Nationa...

Ngày tải lên: 20/02/2014, 15:20

... example, in the case of the verbs play and win, the related set of textual en- tailment expressions derived from the patterns are P nom (win, play) = {“player wins”, “players win”, “player won”, “players ... selectional preference. 1 Agentive nominalization has been obtained adding “-er” to the verb root taking into account possible special cases such as verbs ending in...

Ngày tải lên: 20/02/2014, 12:20

... there are many edges within an area of meaning, there is only a small number of (weak) links between different areas of meaning. To detect the different areas of mean- ing in our local graphs, ... clustering (van Dongen, 2000). The quality of the Markov clustering depends strongly on several parameters such as a granularity factor and the size of the local graph...

Ngày tải lên: 22/02/2014, 02:20

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a GSP-...

Ngày tải lên: 14/02/2014, 14:20

... models of data mining but rather to a mathematical or ’virtual’ representation of the living system of interest in the computer, where Abbreviations FBA, flux balance analysis; ODE, ordinary differential ... Software Access Experiment References Metabolism 1 Amino acid, arginine catabolism to NO and polyamines NG, aorta endothelial cells Low affinity transporter and arginase share...

Ngày tải lên: 14/02/2014, 14:20

... T-cell kinase (ITK) could in uence the infectivity of HIV and also have anti -in ammatory activity. Since 2006, several patients carry- ing a fusion protein, originating from a translocation joining ... directly involved in ligand binding, presumably abolishing the interaction with signaling partners. The remaining mutations alter amino acids located outside the ligand-bindin...

Ngày tải lên: 14/02/2014, 18:20