Tài liệu Báo cáo khoa học: "A SNAPSHOT OF KDS A KNOWLEDGE" pot

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... atoms) and r j is the standard deviation of B factors. The normalized B factors have a zero mean and unit variance. All atoms that satisfy B z ‡ 4 are treated as outliers and discarded. After ... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma- tional rearrangement that exposes the NLS in an extended conformation. Database Structural data are available in...

Ngày tải lên: 14/02/2014, 19:20

14 742 0
Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx

Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx

... 341, 335–351. 3 Lacadena J, A ´ lvarez-Garcı ´ a E, Carreras-Sangra N, Herrero-Gala ´ n E, Alegre-Cebollada J, Garcı ´ a- Ortega L, On ˜ aderra M, Gavilanes JG & Martı ´ nez del Pozo A (2007) Fungal ribotoxins: ... Martı ´ nez-Ruiz A, Garcı ´ a- Ortega L, Kao R, Lacadena J, On ˜ aderra M, Manchen ˜ o JM, Davies J, Martı ´ nez del Pozo A & Gavilanes JG (2001) RNase U2 and al...

Ngày tải lên: 18/02/2014, 08:20

10 608 0
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

... benzo [a] pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases Oksana M. Subach 1 , Diana V. Maltseva 1 , Anant Shastry 2 , Alexander Kolbanovskiy 2 , Saulius Klimas ˇ auskas 3 , ... Wyszynski MW, Gabbara S, Kubareva EA, Romanova EA, Oretskaya TS, Gromova ES, Shabarova ZA & Bhagwat AS (1993) The cysteine conserved among DNA cytosine methylases i...

Ngày tải lên: 19/02/2014, 00:20

14 558 0
Tài liệu Báo cáo khoa học: Catalytic mechanism of SGAP, a double-zinc aminopeptidase from Streptomyces griseus pdf

Tài liệu Báo cáo khoa học: Catalytic mechanism of SGAP, a double-zinc aminopeptidase from Streptomyces griseus pdf

... structural data, a general catalytic mechanism was proposed for aminopeptidases that involves an acidic residue acting as a general acid ⁄ gen- eral base and a di-nuclear metal center participating in binding ... BS (1999) Characterization of the enzymatic activity of PSM: comparison with brain NAALADase. Prostate 39, 28–35. 22 Witkin JM, Gasior M, Schad C, Zapata A, Shippenberg T,...

Ngày tải lên: 19/02/2014, 02:20

13 430 0
Tài liệu Báo cáo khoa học: Solution structure of crotamine, a Na+ channel affecting toxin from Crotalus durissus terrificus venom docx

Tài liệu Báo cáo khoa học: Solution structure of crotamine, a Na+ channel affecting toxin from Crotalus durissus terrificus venom docx

... that protein family. In addition, we show that both its fold and potential surface partially resemble the structural features of the antimammalian scorpion a- neurotoxins and of the human antibacterial ... distance data by dynamical simulated annealing from a random array of atoms. Circumventing problems associated with folding. FEBS Lett. 239, 129–136. 31. Laskowski, R .A. , Rullman...

Ngày tải lên: 20/02/2014, 11:20

11 460 0
Tài liệu Báo cáo khoa học: "The Use of Ooject-Special Knowledge in Natural Language Processing" doc

Tài liệu Báo cáo khoa học: "The Use of Ooject-Special Knowledge in Natural Language Processing" doc

... initial analysis nave been considered, the process which attempts to find causal connections between conceptualizations is activated, in this particular case, the analyzer has already indicated ... CONSUMER of liquids, and a mailbox ts a CONSUMER of mail. Some objects are both SOURCEs and CONSUMERS. A pipe is a CONSUMER of tobacco and a SOURCE of smoke. An Ic...

Ngày tải lên: 21/02/2014, 20:20

6 516 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTA...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... nrdF + gene was sequenced by a primer walking approach. For DNA analysis, dnastar software (DNAS- TAR Inc., Madison, WI, USA) and clone manager 5.0 (Scientific & Educational Software, Cary, NC, USA) ... GTA GGT TGA TTT CAT GTC GAA TG-3¢; additional XbaI site underlined) and OB 3 (5¢-AAA AGA ATT CTT AGA AGT CCC AGT CAT CGT C-3¢; additional EcoRI site underlined). The amplified PCR fragment...

Ngày tải lên: 15/02/2014, 01:20

14 873 0
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... Gribenko AV, Patel MM, Liu J, McCallum SA, Wang C & Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface charge- charge interacti...

Ngày tải lên: 15/02/2014, 01:20

8 740 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... progressive degeneration of dopaminergic neu- rons of the substantia nigra pars compacta (SNpc) and depletion of striatal dopamine. Dopaminergic neuronal death is accompanied by the appearance of Lewy bodies ... Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and Mauro Fasano 1 1 Department of Structural and Functional Biol...

Ngày tải lên: 15/02/2014, 01:20

11 776 0
w