Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing ... Double-stranded cDNA was syn- thesized from the mRNA with a cDNA synthesis kit (TaKaRa, Tokyo, Japan) and used as an ab...
Ngày tải lên : 20/02/2014, 23:20
  • 8
  • 511
  • 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but ... D-amino acid in peptide link- age by an enzyme from frog skin secretions. Proc Natl Acad Sci USA 102, 4235–4239. 33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Kata...
Ngày tải lên : 18/02/2014, 17:20
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... temperature until all free water was evaporated. After this, IR spectra were recorded at room temperature and at 37 °C. Usually, the original spectra were evaluated directly and a spectral analysis ... Chicester. 32. Mu ¨ hlradt, P.F. & Frisch, M. (1994) Purification and partial bio- chemical characterization of a Mycoplasma fermentans-derived substance that activates macroph...
Ngày tải lên : 21/02/2014, 00:20
  • 9
  • 665
  • 1
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... primers; CLGAT 5a (5¢-GGCATCAACAT- CACAAGCAACAAGTGCAAG-3¢), CLGAT5b (5¢-TCCT- CCATCAATCTGCTTCCATGGACCATC-3¢), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC-3) and CLGAT3b (5¢-AAGGGAGAGAAACCTGACCTTGCACTTG-3¢). ... watermelon Kentaro Takahara, Kinya Akashi and Akiho Yokota Graduate School of Biological Sciences, Nara Institute of Science and Technology, Japan Drought in the presence of st...
Ngày tải lên : 20/02/2014, 03:20
  • 12
  • 649
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii Maghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. ... sialidasetypeX,protease enzymes and molecular mass standards were purchased from Sigma. Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemontii were collected from...
Ngày tải lên : 21/02/2014, 00:20
  • 8
  • 616
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1). Table 1. N-Terminal sequences of the polypeptides of the purified enzyme. N-Terminal sequen ... of AF499 was identified as an archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence ()35 to )...
Ngày tải lên : 21/02/2014, 03:20
  • 10
  • 564
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... enzymatic characterization of HpSDH demonstrates its activity with k cat of 7.7 s )1 and K m of 0.148 mm toward shikimate, k cat of 7.1 s )1 and K m of 0.182 mm toward NADP, k cat of 5.2 s )1 and ... 2-({2-[(2- {[2-(2,3-dimethylanilino)-2-oxoethyl]sulfanyl}-1,3-benzo- thiazol-6-yl)amino]-2-oxoethyl}sulfanyl)-N-(2-naphthyl) acetamide (4) and maesaquinone diacetate (5) were...
Ngày tải lên : 19/02/2014, 05:20
  • 11
  • 529
  • 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

... doi:10.1046/j.1432-1033.2002.03108.x Several intermolecular dioxygenases, particularly those of microbial or human origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are ... same way as described for the wild-type cDNA. Data base retrieval Data base searches and sequence alignments were carried out with the ENTRE...
Ngày tải lên : 21/02/2014, 03:20
  • 9
  • 864
  • 0
Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

... sense (VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA ATC-3¢) and vector antisense (VA) (5¢-CCGCTCG AGCTTCATAGAAATAGTCGCCTC-3¢)primerswas cloned into NdeIandXhoI sites of pET22b(+) vector (Novagen). The BL21[DE3]pLysS ... Koichiro Komai and Kazuhiko Matsuda Department of Agricultural Chemistry, Faculty of Agriculture, Kinki University, Nara, Japan Bacillus cereus isolated from the larvae of...
Ngày tải lên : 30/03/2014, 13:20
  • 6
  • 456
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... CCATGTCTGCAGATGGTCGAGG 5¢-RACE Zf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACE Zf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACE Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCR Zftbet-R1 ... CGAGCAGGAGATGGGAACC Real-time PCR Zfbactin-R CAACGGAAACGCTCATTGC Real-time PCR Zfgapdh-F CGCTGGCATCTCCCTCAA Real-time PCR Zfgapdh-R TCAGCAACACGATGGCTGTAG Real-time PCR ZFil...
Ngày tải lên : 16/02/2014, 09:20
  • 20
  • 689
  • 0

Xem thêm