Tài liệu Báo cáo khoa học: "Opinion and Generic Question Answering Systems: a Performance Analysis" ppt

... the ACL-IJCNLP 2009 Conference Short Papers, pages 157–160, Suntec, Singapore, 4 August 2009. c 2009 ACL and AFNLP Opinion and Generic Question Answering Systems: a Performance Analysis Alexandra ... evaluation and comparison of two different approaches to QA a fact-oriented one and another designed for opinion QA scenarios. Related work Research in building fa...

Ngày tải lên: 20/02/2014, 09:20

... and SKC) and a fragment consisting of SK domains B and C (SKBC) at pH 7.0. The data for SKA at pH 7.0 and 0.88 mgÆmL )1 have been taken from Azuaga et al. [19]. Fragments SKA, SKB and SKC show single ... reversible because state A n can dissociate and unfold at high temperatures. Nevertheless, association and dissociation can be slow at certain temperatures and therefore k...

Ngày tải lên: 21/02/2014, 03:20

... differ- ent patent classes and different patent text sections such as title, abstract, and claims, as separate translation tasks, and investi- gate the influence of such tasks on machine translation performance. ... Other ap- proaches have extracted parallel data from similar or comparable corpora (Zhao et al., 2004; Snover et al., 2008). Several approaches have been pre- sented that tr...

Ngày tải lên: 22/02/2014, 03:20

Ngày tải lên: 16/02/2014, 15:20

... (ischemia) of key metabolite concentrations and metabolic fluxes, both measured and nonmeasured. A general parameter sensitivity analysis is carried out to determine and characterize the parameters having ... then glycerol, and finally acetate Logic sim NG NG Single time points of fluxes and mRNA measured by microarrays Asenjo AJ, Ramirez P, Rapaport I, Aracena J, Goles E & Andre...

Ngày tải lên: 14/02/2014, 14:20

... might acetylate active genes in association with the elongating Pol II. In addition to yeast SAGA and NuA4, the mammalian HAT HBO1 is also potentially able to be recruited to and to acetylate H4 ... [85]. Mast cells express GATA-2 as well as NFAT and AP-1, and GATA-2 initiates the formation of an additional discrete GATA-2 ⁄ AP-1 enhanceo- some-like complex existing upstream of the tw...

Ngày tải lên: 14/02/2014, 18:20

... miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a 3´ CGAGUAGUUUCGACCGACACUAU dme-miR-2b ... UTR 5´ AUUGUUUUAUCUUAUCAGUAUUA ||| ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCC-GUCAUAAU hsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAU site 2: ZEB1 3´ UTR 5´ AUGCUAAAUCCGCUUCAGUAUUU |||||||...

Ngày tải lên: 14/02/2014, 19:20

... Hoffman AE, Zheng T, Yi C, Leaderer D, Weidhaas J, Slack F, Zhang Y, Paranjape T & Zhu Y (2009) micr- oRNA miR-19 6a- 2 and breast cancer: a genetic and epi- genetic association study and functional ... matlab, version 201 1a (Mathworks, Natick, MA, USA), we compared localization and strand direction between miRNAs and transcripts (Refseq genes and mRNAs). Intragenic and...

Ngày tải lên: 14/02/2014, 19:20

... reticulum junction, and are activated by membrane depolariza- tion. I caL is important in heart function because it modulates action potential shape and contributes to pacemaker activities in the sinoatrial and ... 1944–1949. 66 D’Alessandra Y, Devanna P, Limana F, Straino S, Di Carlo A, Brambilla PG, Rubino M, Carena MC, Spazzafumo L, De Simone M et al. (2010) Circulating microRNAs ar...

Ngày tải lên: 14/02/2014, 19:20

... Functional and structural analyses of N-acylsulfonamide- linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department ... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and 2xoi Abbreviations PDB...

Ngày tải lên: 14/02/2014, 22:20