Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt

... polikoff}@asel.udel.edu Abstract We will demonstrate the ModelTalker Voice Recorder (MT Voice Recorder) – an interface system that lets individuals record and bank a speech database for ... rerecord an unacceptable utterance. Recordings are automatically labeled and saved and a speech database is created from these recordings. The system s intention is to make the process of recording ... by a profes-sional speaker and manually polished, all other voices were created by untrained individuals, most of whom have ALS, in an untrained setting, with the recordings having no manual...

Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

... (Kurohashi and Na-gao, 1994) or CaboCha (Kudo and Matsumoto,2002). Although this information is less accu-rate than manually annotated information, theseautomatic analyzers provide a large amount ... trainingdata)1.RerankingCandidate 1Candidate 2Candidate 3Candidate 4: Case element: VerbCandidateCandidateFigure 2: Selection of possible parses for rerankingMany methods for reranking the parsing of En-glish ... trainingdata.3 Japanese dependency analysis takingaccount of co-occurrence informationand a combination of multiple casesOne constraint in Japanese is that multiple nouns of the same case do...

Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding afﬁnity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

... role of a mobile loop in substrate binding andenzyme activity of human salivary amylase. J Mol Biol325, 106 1–1 076.15 Ragunath C, Manuel SGA, Venkataraman V, SaitHBR, Kasinathan C & Ramasubbu ... Binding of B. subtilis xylanase mutants with a modiﬁed secondary binding site to water-unextractable arabinoxylan (WU-AX) (A) andoat spelt xylan (OSX) (B) and of A. niger xylanase mutants to water-unextractable ... phenylalanine and aspar-tate. The analysis, starting from protein hydrolysis, wasperformed in quintuplicate.Activity assays For all activity measurements of XBS and its mutants, a McIlvaine...

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding speciﬁcity pdf

... diffracts to a Table 1. Statistics on data collection and reﬁnement. A wavelength of 0.8726 A ˚was used. Rotations of 1° were performed. The Ramachan-dran plot was calculated usingRAMPAGE.X-ray ... assume a veryhigh binding constant of the protein for an extrane-ous ligand.We cannot state that the natural ligand of theH. pylori protein is erucamide, but the shape and size of the cavity ... 147,225 5–2 264.30 Leslie AGW (2006) The integration of macromoleculardiffraction data. Acta Crystallogr D Biol Crystallogr 62,4 8–5 7.31 Evans P (2006) Scaling and assessment of data quality.Acta...

Tài liệu Báo cáo khoa học : Chủ tịch Hồ Chí Minh và bản di chúc hôm nay và mai sau ppt

... dd lan nhau. Dd chfnh la ed ly, ed tinh, chan thanh, thang than, la van hoa Dang, la ban chat tam hdn va dao dQc dan tdc Viet ma Ho Chf Minh mong mdi va gQi lai eho toan Dang, toan ... that trung thanh cua nhan dan", mdi can bd, dang vien, doan vien va thanh nien phai het Idng tan trung vdi nQde, tan hieu vdi dan, phai tham nhuIn va nang cao "dao dQc each ... va giup dd" cudc khang chien eua nhan dan ta. Tuy nhien, la NgQdi sang lap va ren luyen Dang ta, bang dQ cam eua rieng minh, Hd Chf Minh tha'u hieu rang, mgi thang Igi eua Cach...

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAACPEP4_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGCPEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D ... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTTATH1_suc2 AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGCATH1_pep4 ... AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGCATH1_pep4 TTCACTGAAGGTGGTCACGATGTTCCATTGACAAATTACTTGAACGCATTGAACTACGATCCAGAAGCATH1_pLC1 TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTTAATCATTGAGAACAATTTCCTTGATTGS....

Tài liệu Báo cáo khoa học: Disulﬁde bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins ppt

... 2), 3 4–4 3(strand B), 4 6–5 3 (strand C), 5 6–6 0 (strand D), 6 6–7 1(strand E), 7 6–8 5 (strand F), 8 8–9 2 (strand G), 9 6–1 03(strand H), 10 5–1 13 (strand I), and 11 6–1 24 (strand J).The analysis of chemical ... Tyr9 and Gln11 (strand A) , Arg32 (helixII), Val90, Lys92, and Glu94 (strand G), Phe96 andSer97 (strand H), Phe113 (strand I), and Arg120 andVal125 (strand J) (Fig. 7). We can conclude that, atvariance ... unchanged(Fig. 2A) . The quantitative volume analysis of thesepredominant forms indicated that binding site occu-pancies reached a plateau value, for both sites, at a protein ⁄ ligand ratio of...

Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

... 18 9–1 95.21 Stephanou A, Isenberg DA, Nakajima K & LatchmanDS (1999) Signal transducer and activator of transcrip-tion-1 and heat shock factor-1 interact and activate thetranscription of ... TGGACGCGCGTAACCCGCACAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()298) Sense GCGCTGAAGCGCAGGCGGTCAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()218) Sense TGTCCCCTCCAGTGAATCCCAGAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()194) ... 5¢-TCT ATC TCT CGA TGGATA CAG A- 3¢; reverse, 5¢-AGG ACA GTA GAA TTAGGT CAC T-3¢).Knockdown of Hsp10 5a and Hsp105bThe double-stranded RNA targeting Hsp105 (Dharmacon;5¢-GCA AAU CAC UCA UGC AAA...

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

... blot analysis polyclonal antibodies raised againstWhiB1 did not cross-react with WhiB4 and vice versa(data not shown). This may be because of variations inthe antigenic epitopes of WhiB1 and ... ferricyanide at a molar ratio of 1 : 50 : 20 (protein : EDTA : ferricyanide) at25 °C for 30 min. The chelated iron was removed bydialysis against buffer D and was used as apo protein for spectral ... wasgiven and blood was collected after 5 days. The serum wasisolated and the titer was determined by ELISA. Use of animals for the generation of polyclonal antibodies wascarried out with prior approval...

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression proﬁling ppt

... qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78,AaHR39, AaHR78 (B) and AabFTZ-F 1A, AabFTZ-F1B, AaHNF- 4A, AaHNF-4B, AaHNF-4C (C) are presented ... response genes AaE7 5A, AaHR3, AaHR4, AaE78 (B), AaHR39, AaHR78(C), the competence factor AabFTZ-F1 isoforms A and B (C), the hepatocyte nuclear factor isoforms AaHNF- 4A, AaHNF-4B , AaHNF-4C (D),the ... PBM). These transcripts (AaUSP -A, AabFTZ-F 1A , AabFTZ-F1B, AaHR78, AaHNF- 4A, AaHNF-4B, AaHNF-4C, AaSvp and AaERR) werealso analyzed in our in vitro assay. Any kind of ﬂuctu-ation in expression levels...

Xem thêm