Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt

... polikoff}@asel.udel.edu Abstract We will demonstrate the ModelTalker Voice Recorder (MT Voice Recorder) – an interface system that lets individuals record and bank a speech database for ... rerecord an unacceptable utterance. Recordings are automatically labeled and saved and a speech database is created from these recordings. The system s intention...

Ngày tải lên: 20/02/2014, 09:20

... (Kurohashi and Na- gao, 1994) or CaboCha (Kudo and Matsumoto, 2002). Although this information is less accu- rate than manually annotated information, these automatic analyzers provide a large amount ... training data) 1 . Reranking Candidate 1 Candidate 2 Candidate 3 Candidate 4 : Case element : Verb Candidate Candidate Figure 2: Selection of possible parses for reranking Many methods...

Ngày tải lên: 20/02/2014, 12:20

... role of a mobile loop in substrate binding and enzyme activity of human salivary amylase. J Mol Biol 325, 106 1–1 076. 15 Ragunath C, Manuel SGA, Venkataraman V, Sait HBR, Kasinathan C & Ramasubbu ... Binding of B. subtilis xylanase mutants with a modified secondary binding site to water-unextractable arabinoxylan (WU-AX) (A) and oat spelt xylan (OSX) (B) and of A. niger xyl...

Ngày tải lên: 14/02/2014, 19:20

... diffracts to a Table 1. Statistics on data collection and refinement. A wavelength of 0.8726 A ˚ was used. Rotations of 1° were performed. The Ramachan- dran plot was calculated using RAMPAGE. X-ray ... assume a very high binding constant of the protein for an extrane- ous ligand. We cannot state that the natural ligand of the H. pylori protein is erucamide, but the shape a...

Ngày tải lên: 16/02/2014, 14:20

... dd lan nhau. Dd chfnh la ed ly, ed tinh, chan thanh, thang than, la van hoa Dang, la ban chat tam hdn va dao dQc dan tdc Viet ma Ho Chf Minh mong mdi va gQi lai eho toan Dang, toan ... that trung thanh cua nhan dan", mdi can bd, dang vien, doan vien va thanh nien phai het Idng tan trung vdi nQde, tan hieu vdi dan, phai tham nhuIn va nang cao "dao dQc each ......

Ngày tải lên: 17/02/2014, 05:20

... TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC PEP4_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGC PEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC SGA1_D ... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC SGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT SGA1_R TAGAATGGCTTTTGAAAAAAAT...

Ngày tải lên: 18/02/2014, 06:20

... 2), 3 4–4 3 (strand B), 4 6–5 3 (strand C), 5 6–6 0 (strand D), 6 6–7 1 (strand E), 7 6–8 5 (strand F), 8 8–9 2 (strand G), 9 6–1 03 (strand H), 10 5–1 13 (strand I), and 11 6–1 24 (strand J). The analysis of chemical ... Tyr9 and Gln11 (strand A) , Arg32 (helix II), Val90, Lys92, and Glu94 (strand G), Phe96 and Ser97 (strand H), Phe113 (strand I), and Arg120 and Val125 (...

Ngày tải lên: 18/02/2014, 06:20

... 18 9–1 95. 21 Stephanou A, Isenberg DA, Nakajima K & Latchman DS (1999) Signal transducer and activator of transcrip- tion-1 and heat shock factor-1 interact and activate the transcription of ... TGGACGCGCGTAACCCGCAC Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70()298) Sense GCGCTGAAGCGCAGGCGGTCA Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70()218) Sense TGTCCCCTCCAGTGAATCCCAGA Antisense GGG...

Ngày tải lên: 18/02/2014, 06:20

... blot analysis polyclonal antibodies raised against WhiB1 did not cross-react with WhiB4 and vice versa (data not shown). This may be because of variations in the antigenic epitopes of WhiB1 and ... ferricyanide at a molar ratio of 1 : 50 : 20 (protein : EDTA : ferricyanide) at 25 °C for 30 min. The chelated iron was removed by dialysis against buffer D and was used as apo protein f...

Ngày tải lên: 18/02/2014, 12:20

... qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78, AaHR39, AaHR78 (B) and AabFTZ-F 1A, AabFTZ-F1B, AaHNF- 4A, AaHNF-4B, AaHNF-4C (C) are presented ... response genes AaE7 5A, AaHR3, AaHR4, AaE78 (B), AaHR39, AaHR78 (C), the competence factor AabFTZ-F1 isoforms A and B (C), the hepatocyte nuclear factor isoforms AaHNF- 4A, AaHNF-4B...

Ngày tải lên: 18/02/2014, 13:20