Tài liệu Báo cáo khoa học: "Growing Related Words from Seed via User Behaviors: A Re-ranking Based Approach" pdf

... the ACL 2010 Student Research Workshop, pages 49–54, Uppsala, Sweden, 13 July 2010. c 2010 Association for Computational Linguistics Growing Related Words from Seed via User Behaviors: A Re-ranking ... used as a relatively accurate standard for evaluation. We just want to investi- gate whether user behaviors and re-ranking framework is helpful in the related word...

Ngày tải lên: 20/02/2014, 04:20

... the originally high basal activation state in a dose-depen- dent manner, and thus acts as an inverse antagonist of ERRc. ERRs are a subfamily of orphan NRs and are clo- sely related to two ERs: ERa and ... luciferase activity was measured by using Luciferase assay reagent (Promega, Madison, WI, USA) according to the manufacturer’s instructions. SEAP activ- ity was assayed by using Great...

Ngày tải lên: 18/02/2014, 16:20

... for 3¢ and 5¢ nested rapid amplification of cDNA ends (RACE): lemRACE-F1: 5¢-TCGCTGTTGCAGTACCTGGACTCC-3¢; lemRACE- B1: 5¢-GTCTACCAAGTCTCGAAGAAAGTCCTGCTG- 3¢; peaRACE-F1: 5¢-GATGGAGGGCGCGGAGGAT-3¢; peaRACE-B1: ... 5¢-GATGGAGGGCGCGGAGGAT-3¢; peaRACE-B1: 5¢-CTTGCCCCTCATGCCATGGAAC-3¢. For both RACE reactions we used Advantage Taq 2 Mixture (Clontech) and a P. americana RACE library con- structed...

Ngày tải lên: 20/02/2014, 01:20

... 213–222. 66 Hamaguchi M, Hamada D, Suzuki KN, Sakata I & Yanagihara I (2008) Molecular basis of actin reorgani- zation promoted by binding of enterohaemorrhagic Escherichia coli EspB to alpha-catenin. ... Y, Sagara H, Kabe Y, Azuma M, Kume K, Ogawa M, Nagai T, Gillespie PG, Sasakawa C & Handa H (2007) The enteropathogenic E. coli effector EspB facilitates microvillus effacing and anti...

Ngày tải lên: 14/02/2014, 22:20

... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin –1 . Name Sequence ssDNAS d(CATTCCCACCGGGACCACCAC) ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC) ET...

Ngày tải lên: 15/02/2014, 01:20

... by PCR from H. pylori CCUG17874 genomic DNA using the following primers: forward, 5¢-CACCAAACCTTATACGATTGATAAGGCA AAC-3¢; and reverse, 5¢-TTATTATTGGGCGTAAGCT TCTAG-3¢. The construct was cloned ... diffracts to a Table 1. Statistics on data collection and refinement. A wavelength of 0.8726 A ˚ was used. Rotations of 1° were performed. The Ramachan- dran plot was calculated using RAMPAGE...

Ngày tải lên: 16/02/2014, 14:20

... dinitrogen by Bacteria and Archaea. Adv Microb Physiol 52, 107–227. 24 Uthandi S, Saad B, Humbard MA & Maupin-Furlow JA (2010) LccA, an archaeal laccase secreted as a highly stable glycoprotein ... of plant ascorbate oxidase [33], human ceru- loplasmin [34], CotA laccase from B. subtilis [35], and McoA from A. aeolicus [4], and they apparently cor- relate with a structural organi...

Ngày tải lên: 18/02/2014, 04:20

... performed. NOVOstar data parser Java data model Spreadsheet (data and metadata) KineticsWizard Instrument independent SABIO-RK MeMo-RK Experimental data + meta data Parameters + meta data Web/web service Web/web ... search capability for kinetic data and corresponding metadata stored in SABIO-RK. The task of automatically finding para- meters and associated data is aided by specifying and stor...

Ngày tải lên: 18/02/2014, 04:20

... "kha can trdc", nghia la ga gay canh dau, hoac "kha can, cho cam" nghia la ga gay, cho can, cay xoan dau gpi la "can du" td xda den nay van dddc ngddi dan d cac ... thanh ngd, tuc ngd, ca dao in dam phddng ngd xd Thanh, da dda each phat am, each dung td cua dia phddng nay hoa nhap vao ngdn ngd chung cua toan dan, gop phan lam giau cd them kho tang...

Ngày tải lên: 18/02/2014, 05:20

... leaflets. We thus conclude from these data that Ab interacts with the membrane in a Table 4. Average values of deuterium order parameters. Data are the mean (± SD). Simulation Top leaflet plateau ... domain revealed by self- assembly simulations. Proc Natl Acad Sci USA 104, 2631–2636. 20 Khalid S & Sansom MSP (2006) Molecular dynamics simulations of a bacterial autotransporter: NalP...

Ngày tải lên: 18/02/2014, 08:20