Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

... glycogen synthase kinase- 3 and glycogen synthase, in an insulin- dependent manner [49], supports the hypothesis of cross- talk between insulin and integrin -signalling pathways. Thelackofaninsulin-elicitedincreaseinDAG,shown here ... 2003 Insulin signalling in rat hepatocytes (Eur. J. Biochem. 270) 4645 diacylglycerol (DAG) in hormonal induction of S phase in...

Ngày tải lên: 20/02/2014, 02:21

12 592 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... ¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢. Direct measurements of [Ca 2+ ] i in single cells Non-transfected HEK293 cells and HEK293 cells ... (F340) increases, whereas the fluorescence intensity at 380 nm (F380) decreases upon the binding of Ca 2+ . The change in the ratio of F340 ⁄ F380 determined the change in Ca 2+...

Ngày tải lên: 19/02/2014, 18:20

13 730 0
Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

... GGC GTT GC Reverse: GGT TTA CCG AGC CAG TAC CTC T isiA Forward: GCC CGC TTC GCC AAT CTC TC Reverse: CCT GAG TTG TTG CGT CGT TA alr2495 Forward: AAA ACG GCT GCA GTT CTC A Reverse: CCC AAT TGC ... by PCR using the megaprimer strategy [48]. The primers used were: forward mut primer 5¢- GAATTCATGTCTAATCGTCCTATATA TCTTGACT-3¢ (EcoRI site underlined), internal mut primer 5¢-TCCGCTTCTTCCTCCA-3¢...

Ngày tải lên: 18/02/2014, 04:20

11 728 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

... template and the oligonucleotides T1 (5¢-CGACTCGAGAAAAGAGCTGTCACGGGAGT TCCT-3¢), T2 (5¢-CGAGCGGCCGCCCCTCTCACTGGG GAAC-3¢,T3(5¢-CCGGTGCGACTTGTTGAATCCC-3¢) and T4 (5¢-GGGATTCAACAAGTCGCACCGG-3¢). PCR amplification ... Our finding that increasing the NaCl con- centration to 0.3 m dramatically inhibited the anti- bacterial activity of trappin-2 comprises additional evidence demonstrating t...

Ngày tải lên: 18/02/2014, 17:20

13 610 0
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx

Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx

... of the main chains. None of these includes any of the binding sites, but some are located in the vicinity. Three of the regions with different conformation involve calcium binding and four of them ... forming the calcium binding site found in SPRK (and VPRK) are shaded green, residues forming the ‘strong’ calcium binding site in PRK (and in VPRK) are shaded khaki...

Ngày tải lên: 19/02/2014, 07:20

11 551 0
Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf

Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf

... roducts. Their structure w as determined by using chemical methods, NMR and mass spectrometry. All monosaccharides had the D -configuration, andasparticacidhadthe L -configuration. Intact LGL B contained ... were conducted by the Associates of Cape Cod, Inc. (Cape Cod, MA, USA), by using the gel-clot method, and the number of endotoxin units (EU) was compared with control standard e...

Ngày tải lên: 19/02/2014, 16:20

11 632 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... and, for nitrite reductase activity, the protein samples were not boiled. Protein content was determined with the Bicinchoninic Acid Protein Assay Kit (Pierce), using horse heart cytochrome c ... predicted a lipid attachment to Cys24. The deduced amino-acid sequence of NrfA contains four classical c- type heme-binding motifs CXXCH and a fifth heme-binding site CWXCK [17]....

Ngày tải lên: 21/02/2014, 00:20

12 594 0
Tài liệu Báo cáo khoa học: "The Structure and Process of Talking About Doing" pdf

Tài liệu Báo cáo khoa học: "The Structure and Process of Talking About Doing" pdf

... identified, outline a preliminary process model that int•grat•• the report generation with the processes that are generating the actions being reported upon, and specify a systematic methodology ... for this comes ~om the hi|h correlation ~etween Point or view and errors in problem solving actions. Subjects in the ~tlsslonarles and Cannibals task can make errors...

Ngày tải lên: 21/02/2014, 20:20

4 585 0
Tài liệu Báo cáo khoa học: "k-valued Non-Associative Lambek Categorial Grammars are not Learnable from Strings" pptx

Tài liệu Báo cáo khoa học: "k-valued Non-Associative Lambek Categorial Grammars are not Learnable from Strings" pptx

... exactly one occurrence of c (since [[τ n (c) ]] = p −1 S and the other type images are either 1 or p) - Then, this entails that w has exactly one occur- rence of b on the left of the occurrence ... process- ing. They are well adapted to learning perspectives since they are completely lexicalized and an actual way of research is to determine the sub-classes of such grammar...

Ngày tải lên: 20/02/2014, 16:20

8 345 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... the capacity to increase the catalytic efficiency of PhyH-DII. Further- more, the catalytic efficiency of PhyH was much greater than that of PhyH-DI and PhyH-DII combined (5.73 fold) or twice the ... registration number ACCC 05550. Cloning and sequencing of BPP gene phyH phyH (HM003046) was amplified using degenerate PCR and thermal asymmetric interlaced PCR tech- niques. The ful...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
w