Tài liệu Báo cáo khoa học: "Tokenization: Returning to a Long Solved Problem" pdf
Tài liệu Báo cáo khoa học: "Tokenization: Returning to a Long Solved Problem" pdf
... andOntoNotes (Hovy et al., 2006). Clearly, as onemoves towards a more application- and domain-driven idea of ‘correct’ tokenization, a more trans-parent, flexible, and adaptable approach to ... decades. Ap-proximately, this means splitting off punctuationinto separate tokens, disambiguating straight quotes,and separating contractions such as can’t into caand n’t. There are, however, many ... other abbreviations, oddly), an extra period ishallucinated, so the abbreviation also has one. Incontrast, C&J add a period to all final abbreviations,CoreNLP groups the final period with a...
- 5
- 461
- 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf
... antibody on formalin-fixed andparaffin-embedded tissues (Fig. 9). Antibodies againstPCNA and Cdc45 stained malignant cells in a compar-able manner, e.g. on invasive-lobular mamma carci-noma sections ... histological material is a valuable component of conventional histopathologi-cal analysis and may be of major prognostic import-ance [56]. Proliferation in immunohistochemicalsections can be measured ... whereas humanMcm3 seems to be more stable with a half-life of 24 h[7]. To date, no data for the turn-over of the essentialreplication factor Cdc45 have been available. There-fore, we evaluated...
- 16
- 504
- 0
Tài liệu Báo cáo khoa học: Combinatorial approaches to protein stability and structure pdf
... intimate van derWaals packing (like a jigsaw puzzle) [13].The problem can therefore be framed simply: we need a way to (a) make large numbers of variants of proteins and(b) to analyze them rapidly ... [74–76].Chorismate mutase is thought to catalyze a Claisencondensation principally by binding chorismate in a conformation that favors the pericyclic reaction and allowstransition-state stabilization by a ... screening on agar plates, as well asnonreducing SDS/PAGE to identify proteins that migratein a single, tight band. A caveat to this approach is that it is not difficult to thinkof bona fide native...
- 14
- 584
- 0
Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx
... members of the ADAM family have been shown to act as a- secretase [8,36,37]: ADAM9, ADAM10 andADAM17 (TACE). Overexpression of ADAM9 hasbeen reported to increase the basal and protein kinaseC (PKC) ... mecha-nism: ADAM9 has been shown to proteolytically pro-cess ADAM10 [40–42]. By contrast to ADAM9,ADAM10 was found to have constitutive and regu-lated a- secretase activity as well as many other ... Cahuzac N, Guardiola-Serrano F, Huault S,Luckerath K, Friedmann E, Novac N, Wels WS,Martoglio B, Hueber AO et al. (2007) The Fas ligandintracellular domain is released by ADAM10 andSPPL2a...
- 12
- 591
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... generaltranscriptional co-activators that contain histone andtranscription factor acetylation activities [30]. In addi-tion, CBP contains a number of protein-bindingdomains that mediate transcription ... CBP is a structural platform that is capable of binding severaldifferent families of transcriptional activators [30], andevidence indicates that the KIX domain has the ability to simultaneously ... Milne TA, CopelandTD, Levine SS, Lee JC, Hayes DN, Shanmugam KS,Bhattacharjee A, Biondi CA et al. (2004) Meninassociates with a trithorax family histone methyltrans-ferase complex and with...
- 11
- 761
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... Escherichia coli DsbA and DsbC,as well as the isolated catalytic a domain of PDI. Boththe PDI a domain and DsbA have a catalytic site, withan associated substrate-binding site, but lack an inde-pendent ... rhodanesewas also decreased by bacitracin. The decrease in thenoncatalyzed rate (31%) was similar to that of thePDI-catalyzed reaction (a 32% decrease). These resultsFig. 1. Bacitracin has minimal ... showing a greater effect(29% decrease in aggregation rate) than PDI (18%decrease in rate). When 1mm bacitracin was added to the PDI-catalyzed reaction the rate of aggregation ofrhodanese was significantly...
- 9
- 620
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Structure and function of a regulated archaealtriosephosphate isomerase adapted to high temperature.J Mol Biol 342, 861–875.12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S,Balaram H, Balaram ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... mutagenesis.Desired mutation Template gene Constructed mutant Primer sequence (5¢ -to3 ¢) Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaGTCGACaatgcAntisense ARS with PstI and SalI gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttggattttttCTGCAGCAGAGCTCGTTTAGTGAACCGTOP ... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttggattttttCTGCAGCAGAGCTCGTTTAGTGAACCGTOP CcttctccccggcggttagtgctgagagtgcARS aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaS. Ma et al. PABP expression during heat shock ... that, due to the increasedcellular abundance of HSP27, there was an overallCMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’...
- 19
- 596
- 0
Tài liệu Báo cáo khoa học: SREBPs: SREBP function in glia–neuron interactions pdf
... the elongation of docosapentaenoic acid. J Lipid Res43, 1529–1536.46 Matsuzaka T, Shimano H, Yahagi N, Amemiya-KudoM, Yoshikawa T, Hasty AH, Tamura Y, Osuga J,Okazaki H, Iizuka Y et al. (2002) ... 54–63.8 Shimano H, Amemiya-Kudo M, Takahashi A, Kato T,Ishikawa M & Yamada N (2007) Sterol regulatory ele-ment-binding protein-1c and pancreatic beta-cell dys-function. Diabetes Obes Metab 9 ... delta-5 desaturase; D6D, delta-6 desaturase; DPN, diabetic peripheralneuropathy; EFA, essential fatty acid; MUFA, monounsaturated fatty acid; PNS, peripheral nervous system; PUFA, polyunsaturated...
- 9
- 711
- 1
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf
... theexperimental joints was examined to assess any macro-scopic damage caused by experimentally induced OA.Cartilage damage was visualized on the tibial plateauof the experimental joints when compared ... inhibition ofcartilage and chondrocyte degeneration.ResultsMacroscopic and radiographic examination of thearticular cartilage after experimentally inducedOAArticular cartilage of the femoral condyles ... investi-gated the various apoptotic factors that show significance in synovial fluidobtained from normal and experimental osteoarthritic animal models andhave evaluated the effect of hypoxia on articular...
- 11
- 461
- 0
Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM