Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

... 4353 REVIEW ARTICLE Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis Peter Hlavica Walther-Straub-Institut ... P. (1983) Mechanisms of extrahepatic bioactivation of aromatic amines: the r ole of he moglobin in the N-ox...

Ngày tải lên: 19/02/2014, 16:20

26 747 0
Tài liệu Báo cáo khoa học: "Models and Training for Unsupervised Preposition Sense Disambiguation" pptx

Tài liệu Báo cáo khoa học: "Models and Training for Unsupervised Preposition Sense Disambiguation" pptx

... Smoothing and Restarts In addition to the baseline, we ran 100 restarts with random initialization and smoothed the fractional counts by adding 0.1 before normalizing (Eisner, 2002). Smoothing ... by Rudzicz and Mokhov (2003) and O’Hara and Wiebe (2003) to annotate the se- mantic role of complete PPs with FrameNet and Penn Treebank categories. Ye and Baldwin (200...

Ngày tải lên: 20/02/2014, 05:20

6 437 0
Tài liệu Báo cáo khoa học: "Dialogue and Understanding Development Environment, mapping Business Process Models to Information State Update dialogue systeDialogue and Understanding Development Environment, mapping Business Process Modelsms" pptx

Tài liệu Báo cáo khoa học: "Dialogue and Understanding Development Environment, mapping Business Process Models to Information State Update dialogue systeDialogue and Understanding Development Environment, mapping Business Process Modelsms" pptx

... Open Agent Architecture (OAA) (Cheyer and Martin, 2001) and employ the following agents in addition to DIPPER: Grammatical Framework (GF) parser (Ranta, 2004) (java) BPM agent (java) and Database ... ask for cinema name), when appropriate. Domain-general aspects of dialogue (e.g. confirmation and clarification strategies) are handled by the core DM. Values for con- straints on...

Ngày tải lên: 22/02/2014, 02:20

4 345 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... Software Access Experiment References Metabolism 1 Amino acid, arginine catabolism to NO and polyamines NG, aorta endothelial cells Low affinity transporter and arginase share the control of the ... point of metabolites and fluxes measured by assays and radio labeling Go ´ mez-Casati DF, Cortassa S, Aon MA & Iglesias AA (2003) Planta 216, 969–975. 39 Carbohydrate, sucrose...

Ngày tải lên: 14/02/2014, 14:20

91 733 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... these advances have been accompanied by a relative decrease in the number of studies aimed at gaining an understanding of the structural conformation of chromatin, and the changes in chromatin ... clear that active chromatin has a structure that is very different from inactive chromatin and that struc- tural studies are indeed required to gain a detailed understa...

Ngày tải lên: 14/02/2014, 18:20

29 743 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGU GY-box family miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a 3´ ... demonstrate the highly com- plex regulation of signal cascades and the physiological and pathological roles of miRNAs. Hence, further investigations aiming to elucidate...

Ngày tải lên: 14/02/2014, 19:20

9 684 0
Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc

Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc

... methylated not only in invasive ductal carcinoma, but also in ductal carci- noma in situ and the intraductal component of invasive ductal carcinoma [34]. In addition, an in vitro experi- mental ... highly complementary target mRNAs, the mature RISC complex cleaves target mRNAs via a catalytic domain (RNase III domain) of Argonaute proteins, a core component of the...

Ngày tải lên: 14/02/2014, 19:20

12 636 0
Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt

Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt

... data indicate that miRNAs are important regulators of cardiac fibrosis and are involved in structural heart disease. Arrhythmia The electrical activities of the heart (i.e. the rate and force of ... Nishi H, Iwanaga Y, Nagao K, Ki- noshita M, Kuwabara Y, Takanabe R, Hasegawa K, Kita T et al. (2009) MicroRNA-133 regulates the expression of GLUT4 by targeting KLF15 and...

Ngày tải lên: 14/02/2014, 19:20

15 684 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... Discussion Sulfonimides as inhibitors of RNase A We began by determining the ability of three backbone analogs of RNA to inhibit catalysis by RNase A. These analogs have a simple polyanionic backbone with neither a ... encourage the further development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Struc...

Ngày tải lên: 14/02/2014, 22:20

9 627 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... coordinated by the side chain of Asp201, a phosphate ion and five water molecules. The phosphate involved in this interaction is bound by main chain interactions with Lys76 and Gly77 and the side chain of ... nucleotide being added to crystallization solutions. The ligand bound was interpreted as GMP because the N2 of the base makes a hydrogen bond to a ma...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
w