Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx

Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx

... didn cam giup khcd day cac chidu canh cam xdc phong phu d ngudi nghe. Mudn dat dugc didu dd, ngudi dgc phdi cd dugc cam gidc hda nhdp vdi cdu chu, rang ddng thyc sy vdi nhung didu dang dgc. ... ro chu thi de dgc didn cam, ngucd dgc khdng chi can co chdi gigng dep, sang, am, ma quan trgng la cd nghe thudt sit dung cac phuang tien ngd dm: biet each ngdt nghi nhanh lau, biet cbd .....

Ngày tải lên: 17/02/2014, 05:20

6 742 1
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA ... sense, 5¢-CCGAGATCTGGCTTTTACTTAAACCG-3¢; IL6R antisense, 5¢-CAGGAATTCACTTGCTCTGTCACCC-3¢; GAPDH sense, 5¢-GCGAATTC...

Ngày tải lên: 18/02/2014, 04:20

9 541 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... mass of the recombinant HpSDH, which is in good agreement with the theoretical molecular mass of 30 041 Da calculated according to the amino acid sequence. This result thereby demonstrates the ... sequencing result, a pair of PCR primers (sense: 5¢-GCGCATCCATATGAAATTAAAATCGTTTGG-3¢ and antisense: 5¢-CCGCTCGAGAAAAACGCTTCGCATGAC- 3¢) were synthesized to clone aroE gene from H. p...

Ngày tải lên: 19/02/2014, 05:20

11 529 0
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

... the higher fluorescence and less accessibility to collisional quenchers of the bound e-ADP, which is characteristic of G-actin [40]. Moreover, the affinity of Pi to G-actin is an order of magnitude ... F-actin. Cofilin induced allosteric changes in the nucleotide cleft of F-actin are also indicated by an increase in fluorescence emission and a decrease in the accessibility...

Ngày tải lên: 19/02/2014, 07:20

9 488 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

... AGC CCC CTC GAG TCG TTC AG-3¢ Reverse sad, cloning 55¢-CGT CAC GGT ATT CGA AGC C- 3¢ Forward mao, RT-PCR 65¢-CAC TGG CTA ATT CCA GTG C- 3¢ Reverse mao, RT-PCR 75¢-CAC TAG CGA AGA TGC CGT C- 3¢ Forward ... RT-PCR 85¢-CCA ACG CAG AAA CTC GGC-3¢ Reverse sad, RT-PCR 95¢-CGG CAT TAT CGG TGA CAG C- 3¢ Forward mabO, RT-PCR 10 5¢-CGC GCA ACA CTG AGG GAC-3¢ Reverse mabO, RT-PCR c- N-methylaminobu...

Ngày tải lên: 19/02/2014, 07:20

9 525 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... suggest a role for the PDGF -C in the development of lung fibrosis. One of the characteristics of pancreatic cancer is the overproduction of extracellular matrix by interstitial cells. This results ... factors show a high sequence identity. The four PDGFs are inactive in their monomeric forms. They share the same receptors; the PDGF receptor-a and -b. These receptors d...

Ngày tải lên: 19/02/2014, 07:20

19 558 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... monomer (the Ôcytochrome b, subunit 7, subunit 8 coreÕ). Cytochrome b is colored blue, subunit 7 is colored pink, and subunit 8 is colored green. The arrow labeled (a) points to the N-terminus of cytochrome ... decrease was found in the case of subunits 7, 8 and 9. Cytochrome bc 1 subunit analysis of cytochrome b deletion mutants Crystal structures of the bc 1...

Ngày tải lên: 19/02/2014, 12:20

10 518 0
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

... protocols. PCR pri- mers located in the second and third exons of the human CRYGN gene were used for amplification: NgcdsA, TCTC TATGAAGGCAAGCACTTCACAGG; NgcdsB, CCGTC CCCGTACACCTTGATGGTGTTC. Bands ... testis at Life Technologies (now Invitrogen). Libraries were screened for human cN-crystallin expression by PCR, using these prim- ers: NgcdsA, TCTCTATGAAGGCAAGCACTTCACAGG; NgcdsB, CCGTCCC...

Ngày tải lên: 19/02/2014, 17:20

16 561 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

... I Sense: 5¢-CGGGATCCTAGACCGGCTAACAAGTA-3¢ Antisense: 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ Rat (gi:474939) prolylhydroxylase alpha I Sense: 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ Antisense: 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ Mouse ... II Sense: 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ Antisense: 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ Rat (gi: 6754969) prolylhydroxylase alpha II Sense: 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ Anti...

Ngày tải lên: 20/02/2014, 02:21

8 434 0
Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

... a day prior to transfection with 5 lg of total plasmid DNA: pCISGa q or pCISGa 16 in presence or absence of pCISM1R or pCISM2R ⁄ pCISC5aR (Ga ⁄ R ¼ 0.4 ⁄ 0.6), respectively. The total amount of DNA ... activation of Ga 16 and Ga q subunits. Therefore the lack of change in the rate of degradation cannot be due to lack of receptor-activa- tion of the alpha subunits...

Ngày tải lên: 20/02/2014, 03:20

13 465 0
w