Tài liệu Báo cáo khoa học: A FYVE-containing unusual cyclic nucleotide phosphodiesterase from Trypanosoma cruzi docx

... multigene family. Mol Biochem Parasitol 30, 205–217. 7 Sanchez MA, Zeoli D, Klamo EM, Kavanaugh MP & Landfear SM (1995) A family of putative receptor-ade- nylate cyclases from Leishmania donovani. ... 17551–17558. 8 Alexandre S, Paindavoine P, Tebabi P, Pays A, Halleux S, Steinert M & Pas E (1990) Differential expression of a family of putative adenylate ⁄ guanylate cyclase gen...

Ngày tải lên: 19/02/2014, 07:20

... glottalization is usually associated with fragments, not all fragments are glottalized. In our database, 62% of fragments are not glottalized, and 9% of glottalized reparanda offsets are ... these cases as repairs, as well as to distinguish them from nonfrag- ment repairs. Thus, pausal duration may serve as a general acoustic cue for repair detection, particularly for the class ....

Ngày tải lên: 20/02/2014, 21:20

... classifica- tion task. Naive Bayes classifier was trained on our corpus and tested on three data sets. The re- sult demonstrated that the classifier achieved more than 80% accuracy in each data ... Type A is a table in which the leftmost column acts as a header, and there are indicators in that column. Similarly, type B is a table in which the first row acts as a header. The table illus...

Ngày tải lên: 20/02/2014, 12:20

... information for the functional analysis of plant DEVH box RNA helicases, and suggest that AtHELPS, as an impor- tant negative regulator, plays a role in K + deprivation stress. Abbreviations ABA, abscisic ... plants. The average GUS activity was obtained from at least five indepen- dent transformants, and each assay was repeated three times. RNA extraction For RNA isolation, the plant tiss...

Ngày tải lên: 14/02/2014, 18:20

... Zhao J, Chang AC, Li C, Shedden KA, Thomas DG, Misek DE, Manoharan AP, Giordano TJ, Beer DG & Lubman DM (2007) Comparative proteomics analysis of Barrett metaplasia and esophageal adenocarcinoma using ... Miyazaki A, Nabeta Y, Hiroh- ashi Y, Kanaseki T, Yamaguchi A, Yamada N, Hiray- ama K, Suzuki M et al. (2002) Natural antigenic peptides from squamous cell carcinoma recognized by aut...

Ngày tải lên: 14/02/2014, 19:20

... Whereas many tropical and subtropical species have only limited capacities to cope with low temperature, plants from temperate climates, such as Arabidopsis thaliana, grow at low temperature and can ... measured with an infrared gas analysis system (Uras 3 G; Hartmann & Braun AG, Frank- furt am Main, Germany). A whole-rosette cuvette design was used as described in [31]. Gas exchange...

Ngày tải lên: 14/02/2014, 22:20

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... beta-turn sequence. J Mol Biol 373, 211–218. 20 Prajapati RS, Das M, Sreeramulu S, Sirajuddin M, Srinivasan S, Krishnamurthy V, Ranjani R, Ramakrish- nan C & Varadarajan R...

Ngày tải lên: 15/02/2014, 01:20

... the dynamic mammalian glycome. Proc Natl Acad Sci USA 104, 11534–11539. 14 Tateno H, Uchiyama N, Kuno A, Togayachi A, Sato T, Narimatsu H & Hirabayashi J (2007) A novel strat- egy for mammalian ... MS. Abbreviations AAL, Aleuria aurantia lectin; AFP, a- fetoprotein; GGDB, GlycoGene Database; GlycoProtDB, GlycoProtein Database; GMDB, Glycan Mass Spectral Database; HCC, hepatocellular...

Ngày tải lên: 16/02/2014, 08:20

... the mRNA of b-catenin were 5¢-AAAGCTGATATTGATGGACAG-3¢. The siRNA against luciferase mRNA was used as a control siRNA. The target sequence for luciferase mRNA was 5¢-AACG TACGCGGAATACTTCGA-3¢. ... Eberhart CG & Argani P (2001) Wnt signaling in human development: beta-catenin nuclear translocation in fetal lung, kidney, placenta, capillaries, adrenal, and cartilage. Pediatr Dev Pathol .....

Ngày tải lên: 18/02/2014, 06:20

... primary antibodies: polyclonal rabbit anti-PPARc, anti-C ⁄ EBPa, anti-C ⁄ EBPb (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and anti-PPARa (Zymed Laboratories, South San Francisco, CA, USA), ... treated as described in (A) . Total RNA was prepared at the indicated times and subjected to quantitative real-time PCR analysis. The data shown are mean value ± standard errors of the mean from...

Ngày tải lên: 18/02/2014, 08:20