Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt
... C)AATTTC-3¢ PsCBL (degenerate forward)45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse)55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward)65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR ... T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward)25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse)35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL ... nucleolus and sti-mulated by phosphorylation with CK2 and cdc2 proteinkinases. Plant J 25, 9–17.32 Yadav N, Chandok MR, Prasad J, Bhattacharya S,Sopory SK & Bhattacharya A (1997) Characterization Stress-induced...
- 19
- 706
- 0
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt
... follows: HSF 1a forward,5¢-GAAGCAGCTTGTCCAGTACACCAA-3¢; HSF 1a reverse, 5¢-TTCCAAGAGCTGAACAAACCATTG-3¢;HSF1b forward, 5¢-GAAGCAGCTGGTCCAGTACACCTC-3¢; HSF1b reverse, 5¢-GGCTGAATAAACCATGCCAGTAGC-3¢; ... toextract total RNA for RT-PCR, were obtained from theNikko Branch of the National Research Institute of Aquaculture (Tochigi, Japan) and reared on a commercialdiet at 15 °C. Cloning of HSFcDNA A ... Plasmid Cloning kit (Invitrogen) and was used as the PCR template. For5¢-RACE, the first PCR was performed with the M13 reverseprimer (5¢-AGCGGATAACAATTTCACACAGG-3¢)asasense primer and a rainbow...
- 10
- 538
- 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx
... withinthe last 30 years. The greatest number of RIPs havebeen found in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereasagglutination was inhibited by galactose and its deriva-tives [such as N-acetylgalactosamine (GalNAc),methyl -a- d-galactopyranoside], it was evident that, atdoses ... displayed hemagglutination and toxicitytoward mice (data not shown), additional efforts tocleanly isolate the isoform were not successful and further characterization was abandoned. A chromato-focusing...
- 12
- 763
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... GTT GGA ATT CCA TCA TCA TCATCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAGGAG GGA TAT GGG GAA C. The PCR reaction wasdone as described above. The amplified ... T. reesei DNAwith the following primers: forward, GGG GAC AAGTTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGTCAG GTC CCT CTC G; and reverse, GGG GAC CACTTT GTA CAA GAA AGC TGG GTC A GT GGT GGTGGT ... oxidase, Japanese patent 61115488.37 Yamada Y, Tawara Y & Yoshika H (1983) Production of heat-resistant polyphenol oxidase, Japanese patent60062980.38 Abdel-Raheem A & Shearer CA (2002)...
- 14
- 650
- 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf
... complexthan in T cells, with several peaks of nuclease hyper-sensitivity [85]. Mast cells express GATA-2 as well asNFAT and AP-1, and GATA-2 initiates the formation of an additional discrete GATA-2 ... typically recruitHATs such as SAGA and NuA3, which mainly acety-late histone H3, and NuA4 which acetylates histone H4on K5, K8 and K12. This cascade of events leads torecruitment of transcription ... H4-K16,the NuA4 group of HATs are essential for H4-K5, K8 and K12 acetylation [136–138]. In yeast, this group ismade up of NuA4 and Piccolo NuA4 which both uti-lize Esa1 as the HAT, and Esa1 was found...
- 29
- 743
- 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx
... UGUUGUUUUAGUGAUCAGAAGGUGY-box family miRNABrd-box: 5´ AGCUUUA |||||||dme-miR-4 3´ AGUUACCAACAGAUCGAAAUAdme-miR-79 3´ UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a ... cycleCell survivalmiR-278Site1:Expanded UTR 5´ AAAUGUAAACGAAAA-CCCACCGU ||||| |||||| ||||||| dme-miR-278 3´ UUUGCC UGCUUUCAGGGUGGCUsite2:Expanded UTR 5´ AGAUGGUAAAAUACACGAG CCACUGA ||:||| ... AUGCUAAAUCCGCUUCAGUAUUU ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCCGUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUTGF- s/BMPsR-smadspri-miR-21,19 9a pre-miR-21,19 9a DroshaDGCR8p68SignalMAPKKKERKmiR-21Spry1,...
- 9
- 684
- 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... and ACCAGCTGGGCCAACATTTC; collagen III:TGGACAGATGCTGGTGCTGAG and GAAGGCCAGCTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGGAGCCATTGTCACACAC; and glyceraldehyde-3-phosphatedehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTACCACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCCACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAACCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTTCAA and ACCAGCTGGGCCAACATTTC; ... death.Many researchers have investigated cell transplantationas an alternative treatment for heart disease. Bonemarrow-derived mesenchymal stem cells (MSCs) areeasily obtainable and expandable,...
- 11
- 653
- 0
Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx
... properties and has a value of 0.5; if no similarity exists, the parameter has a value of 1Polarity change If the mutant causes polarity or charge changes. Change equals unity and no change equals zeroConservation ... energy parame-ters are partly correlated, as are conservation and accessibility, and secondary structure and accessibility.The four parameters that reflect amino acid propertiesare also correlated. ... surface possess fewer spatialrestraints and are thereby less often correlated withsevere mutations. Other intuitively important factorsare the similar amino acid variable and size changevariable,...
- 14
- 561
- 0
Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc
... 153–208.37 Kawahara T, Kohjima M, Kuwano Y, Mino H,Teshima-Kondo S, Takeya R, Tsunawaki S, Wada A, Sumimoto H & Rokutan K (2005) Helicobacter pylorilipopolysaccharide activates Rac1 and transcription ... Theintensities of immunoreactive bands forHA-Noxo1b and HA-Noxo1c in (B) werequantified using a LAS-1000plus (Fuji film)image analyzer and expressed as the foldincrease relative to that of the band forNoxo1c ... CREST, Japan Science and Technology Agency, Saitama, Japan3 Department of Urology, Kyushu University Graduate School of Medical Sciences, Fukuoka, JapanMembers of the NADPH oxidase (Nox) family...
- 15
- 632
- 0
Tài liệu Báo cáo khoa học: Structure and function of plant aspartic proteinases pptx
... Molecular and biochemical characterisation of two asparticproteinases TcAP1 and TcAP2 from Theobroma cacao seeds.Planta 215, 754–762.12. Park, H., Yamanaka, N., Mikkonen, A. , Kusakabe, I. &Kobayashi, ... distributed among families A1 , A3 , A1 1 and A1 2 of clan AA, and family A2 2 of clanAD. The majority of plant APs belongs to the A1 family,together with pepsin-like enzymes from many differentorigins.In ... phytepsin was purified from barley (H. vulgare)(acces-sion number: X56136); AtAsp1, AtAsp2 and AtAsp3 are A. thalianaaspartic proteinases (accession numbers: U51036, AY070453 and AF076243, respectively);...
- 9
- 605
- 0
Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ