Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme Tomohiko Gohya 1 , Xuhong Zhang 2 , Tadashi Yoshida 2 and Catharina T. ... at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was max...

Ngày tải lên: 19/02/2014, 05:20

... 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC CATGTTGCTACTGAATTTCTGCA-3¢ ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ( 1) Protein containing DNAJ d...

Ngày tải lên: 18/02/2014, 06:20

... LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed ... Wellenreuther and W. Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the...

Ngày tải lên: 18/02/2014, 06:20

... 0.01Æmin )1 ) the chase are the average of two independent assays. All data points between the two independent assays have a standard deviation < 10%. From this data, the rate of substrate dissociation, ... m M guanosine, 10 mM MgCl 2 , 50 m M Mes (pH 7) and substrate (5¢-G 2 CCCUCUAAAAA-3¢)at50°C [6]. c Substrate-cleavage reaction (exogenous guanosine-mediated)...

Ngày tải lên: 18/02/2014, 18:20

... respectively [39]. The structure- based calculations provide a DC p of )4 07 calÆmol )1 ÆK )1 and DASA apolar and DASA polar of )1 354 and )7 77 A ˚ 2 , indicating that more of the apolar residues are buried on complex ... program [41]. The DC p was calculated using the following equa- tion: DC p ¼ 0:45DASA apolar À 0:26 ASA polar where DASA apolar...

Ngày tải lên: 19/02/2014, 05:20

... spectrometry and assigned to be free CoA (peak 1), acetyl-CoA (peak 2) (Z)-3-MG-5-CoA (peak 3) (E)-3-MG-5-CoA (peak 4) and (E)-3-MG-1-CoA (peak 5). The determined relative molec- ular masses (MW) of the ... oligonucleotides AUH FW 5¢-AGCTCATATTCTCTGTGCGAGTCCTCGATG GC-3¢ and AUH RP 5¢-GCCATCGAGGACTCGC ACA GAGAATATGAGCT-3¢ (the c.719C>T mutation leading to the ami...

Ngày tải lên: 19/02/2014, 07:20

... chromosomal B. subtilis DNA as template and the oligonucleotides 5¢-TTGGTG GGATCCGTGACTCG AGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTT GTCG ACTTATCGCACACTATAGCTTGATG-3¢ as primers (restriction sites are underlined ... isopentenyl diphosphate isomerases were found in the genomes of Archaea and of certain eubacteria but not in the genomes of fungi, animals and plants. The analysis...

Ngày tải lên: 19/02/2014, 13:20

... h and then cut with ClaI (C and D). DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C). The DNA was then electrotransferred ... mitoDC- 81 alkylates mtDNA in mitochondria or cells. The reasons for the lack of alkylation of mtDNA within mitochondria by mitoDC-81 are unclear. The local concentrati...

Ngày tải lên: 20/02/2014, 11:20

... 5.5 and 7.5, and at 20 °C. (A) Normalized averaged time course of HSA -heme- Fe(II) nitrosylation at pH 5.5 (trace a) and 7.5 (trace b), and at 20 °C. The time course analysis according to Eqn ( 6) ... 10 4 m )1 Æcm )1 . The optical absorption spectra of HSA -heme- Fe(II) and HSA -heme- Fe(II)-NO Table 1. Values of thermodynamic and kinetic parameters for red...

Ngày tải lên: 16/02/2014, 14:20

... found to have a molecular mass of 64 kDa, and to contain two tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involved in ... (B) Macula (M) and transitional epithelial (TE) regions. Intense hybridiza- tion signals were observed in the cells at the periphery of the mac- ula (...

Ngày tải lên: 18/02/2014, 17:20