Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... characteristics of protein arginine methyltransferase 1 and 3 toward the Ewing sarcoma protein and a peptide. Proteins 61, 164–175. 48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S, Pintar A, ... (EWS) oncogene contains an N-terminal transcrip- tion activation domain and a C-terminal RNA-binding domain. Although the EWS activation domain is a potent transactivation domain that is...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Catlin BW (1990) Branhamella catarrhalis: an organism gaining respect as a pathogen. Clin Microbiol Rev 3, 293–320. 2 Karalus R & Campagnari A (2000) Moraxella catarrh- alis: a review of an ... AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) This study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19] Kan FP CTC ATC GAG CAT CAA ATG (...

Ngày tải lên: 18/02/2014, 14:20

14 675 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG Heat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT HSP23 CGTCCGATTTCTTCTCGTGTTT ACCAGAAGACATTACAGTGAAAATTGA Chaperonin-containing ... GCCCCCCTCCCACACA CATCTTCGGCCGTCTTTCC CTSL GTTCTTGTTCCTGCTCATCAGTATG TGGATCGCCAAAAACTCATG QM protein AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA HYPK GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCT...

Ngày tải lên: 18/02/2014, 16:20

11 571 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... macromolecule-64 (OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of this protein, we revealed that the aggregate also contains the inner ear-specific collagen otolin-1 [9]. Results Cloning ... [9]. Results Cloning of cDNA and DNA encoding OMM-64 To obtain cDNA clones encoding proteins contained in the HMW aggregate, immunos...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... cerevisiae strain GIL77 Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAG GTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCA AAGGAACTCTTCT-3¢), corresponding to the N- and C-terminal sequences of b-amyrin synthase from ... characterization of a cDNA encod- ing b-amyrin synthase involved in glycyrrhizin and soyasaponin biosynthesis in licorice. Biol Pharm Bull 24, 912–916. 16 Hayashi H, Huang P, Inoue K...

Ngày tải lên: 19/02/2014, 07:20

12 705 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... IFN-inducible transcriptional activation in the absence of the STAT2 DNA binding domain as determined by Affymetrix DNA microarray analysis. Total mRNA samples from U 6A- 2, U 6A- 2VV-II and U 6A cells ... STAT2 DNA binding domain as revealed by DNA microarray We used DNA microarray analysis to compare the gene expression profiles of U 6A (STAT2-deficient), U 6A- 2 (intact STAT2), and U...

Ngày tải lên: 19/02/2014, 07:20

13 460 0
Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢; and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAG UUCUG-AG-3¢. The forward sequence of the scrambled RNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAG AG-3¢. OVISE cells were plated ... the activity assay. The main fraction contained a 75 kDa matriptase as a major component and a few contamin- ating proteins as analyzed by SDS ⁄ PAGE. RNAi experiments with OVISE cell...

Ngày tải lên: 19/02/2014, 07:20

13 603 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

... ACCACTTTGTACAAGAAAGCTGGGT yef1hisf CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC yef1hisr GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG pos5hisf CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC pos5hisr CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAATCGATGAATTCGAGCTCG pos5leu21.6f CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCCAATTCTGTGTTTCCCGGAAATG p...

Ngày tải lên: 20/02/2014, 01:20

13 560 0
Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... cDNA encoding a truncated protein lacking the transmembrane and cytosolic domains in- frame with the FLAG peptide) per dish. GeneJuice transfection reagent was used at a ratio of DNA to reagent of ... provide additional critical infor- mation over that obtained from X-ray data alone. The knowledge gained from these mutagenesis data will be valuable in directing the design of...

Ngày tải lên: 20/02/2014, 01:20

9 789 2
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

... morphogenesis, a sixfold elevation in eEF 1A specific activity is accompanied by a dramatic increase in protein methylation at as many as nine lysine residues, without any change in the protein or mRNA levels [43]. ... technique and a- cyano-4-hydroxycinnamic as matrix, and analysed by using a Voyager-DE PRO mass spectrometer (Applied Biosystems, Framingham, MA, USA). Intern...

Ngày tải lên: 21/02/2014, 00:20

12 552 0
w