Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

... proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and Molecular Biology Division, Saha Institute ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Er...

Ngày tải lên: 18/02/2014, 16:20

14 635 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... c 1 and a disappearance of the intermediate form of the Rieske protein. At the same time, the levels of subunits 7, 8 and 9 significantly decreased in this mutant strain. However, the amounts of ... around the catalytic core of the enzyme to arrive at the three dimen- sional organization revealed by the crystal structures (Fig. 1A) . The supernumerary subuni...

Ngày tải lên: 19/02/2014, 12:20

10 518 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

... are characterized by a conserved array of 20 cysteines and the absence of His and aromatic amino acids. MT3 contains 68 amino acids with 70% sequence identity to the MT1 and MT2 (MT1 ⁄ 2) isoforms. ... kinetically labile, allowing rapid intra- molecular and intermolecular metal transfer. This is a direct consequence of the relatively high structural dynamics and fle...

Ngày tải lên: 16/02/2014, 15:20

10 569 0
Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc

Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc

... biomaterials based on layered silica, of titania and of zirconia [32]. This view is based on the finding of a dual role for silicatein as an ana- bolic (silica polymerase) and catabolic enzyme (silica esterase), ... a Finnigan MAT mass spectrometer 8230 (Midland; Canada). In a control assay, the reaction was performed in the absence of silicatein. Esterase activity T...

Ngày tải lên: 18/02/2014, 16:20

9 576 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... catalytic efficiency and substrate specificity of PRTFDC1 was further characterized using a radiochemical assay with tritium-labeled bases as substrates, whereas the struc- tural basis for substrate recognition and ... phosphoribosyl- transferase activity [10]. The structural characterization of numerous com- plexes of the human HPRT and several bacterial and pro...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

... The observation that self-asso- ciating peptides and proteins are at the core of several neurodegenerative diseases has led to a massive effort aiming to understand the physiologically relevant structures ... collected and aver- aged for each experiment. ATR-IR spectroscopy Aliquots of samples were taken from each of the samples used for CD spectroscopy and dried over...

Ngày tải lên: 18/02/2014, 04:20

10 562 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

... has fundamen- tal structural, thermodynamic and mechanistic features in common with the dual-flavin family of reductases, there are unique aspects related to NO synthesis that constrain and shape ... suggest that K eq A and the associated k on and k off conforma- tional rates are primary factors in regulating the cyto- chrome c reductase activity of NOS enzymes, particul...

Ngày tải lên: 18/02/2014, 11:20

16 640 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

... (wt) and N18 9A mutant of MR with NADH. The wt trace is fit to a single exponential and the N18 9A trace to a 4-exponential function – see the main text for more details. (Inset) The same data on a ... 2009) doi:10.1111/j.1742-4658.2009.07121.x At least half of all enzyme-catalysed reactions are thought to involve a hydrogen transfer. In the last 10 years, it has be...

Ngày tải lên: 18/02/2014, 11:20

12 596 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... coordinated by cysteines located in both of the large PSI subunits, PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE are located at the cytosolic ... plastids, mitochondria and bacteria. They are also the basic prototypes for a large family of diflavin electron transferases with common functional and structural p...

Ngày tải lên: 18/02/2014, 11:20

17 635 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations Mousumi Banerjee 1 , Hemalatha Ba...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
w