Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog Yoichiro Abe 1 , Yoshiko Kita 1 and Takako Niikura 1,2 , * 1 Department of Pharmacology, ... suggest that mammalian Gup1 acts as a negative regulator of the N-terminal palmitoylation of Shh. Discussion In this report, we fo...
Ngày tải lên: 18/02/2014, 16:20
... expected molecular mass of OTUB1 as well as the area above (rectangle) was excised and digested with trypsin. Digested material was analysed by a nano-LC Ion Trap mass spec- trometer. For the peptide ... immunoprecipitation of OTUB1. As a control, lysate was incubated with agarose without the antibody. Immunoprecipitated material was analysed by SDS ⁄ PAGE and silver staining,...
Ngày tải lên: 16/02/2014, 15:20
... s-DAPK-1Dtail was almost as active as full- length DAPK-1 (Fig. 4C). These data indicate that the ‘tail’ of s-DAPK-1 has a negative regulatory function with regard to s-DAPK-1 activity, and that its ... integrin-mediated polarity pathway. J Cell Biol 172, 619–631. 10 Inbal B, Bialik S, Sabanay I, Shani G & Kimchi A (2002) DAP kinase and DRP-1 mediate membrane blebbing and the...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Endovanilloids Putative endogenous ligands of transient receptor potential vanilloid 1 channels docx
... G .A. , Finazzi-Agro, A. , Vliegenthart, J.F. & Maccarrone, M. (2002) Oxygenated metabolites of ana- ndamide and 2-arachidonoylglycerol: conformational analysis and interaction with cannabinoid ... products of AA and anandamide to act as endogenous activators for TRPV1 in vivo in light of the above mentioned criteria. N -arachidonoyldopamine Biosynthesis N-arachidonoyldopamine...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx
... from sulfonoquinovosyl diacylglycerols of sea urchin. Trans- plantation 74, 261–267. 3 Mizushina Y, Watanabe I, Ohta K, Takemura M, Sahara H, Takahashi N, Gasa S, Sugawara F, Matsuk- age A, Yoshida S & Sakaguchi ... alga, Gigartina tenella. Chem Pharm Bull (Tokyo) 46, 684– 686. 5 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugaw- ara F, Matsukage A, Yoshida S & Sakaguchi K (1999) A...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx
... two-exponential association model. k obs(rapid) and k obs(slow) are the observed association rate constants for the rapid and slow association phases, respectively. The values for the constants are means ... [ 125 I]TC-PCSK9-D374Y that remained bound after 6 h was about 45%. The dissoci- ation rate constants [k off ] for the rapid phase [k off(rapid) ] and for the slow phase [k off(sl...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... expression was induced by addition of IPTG (1 mm) and Ca 2+ (1 mm) for 20 h at 20 °C. Culture supernatants and cell pellets were assayed for phytase activity and separated by SDS ⁄ PAG...
Ngày tải lên: 14/02/2014, 15:20
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank ... USA Introduction Upon catalyzing the cleavage of RNA, RNases operate at the crossroads of transcription and translation. Bovine pancreatic RNase A (EC 3.1.27.5) is the best...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc
... ACCCGATGATAGGCTTC Y11 5A CGCTGGAAACCTCTTGG GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT ... CCGTAGCACATGTCCA H428D AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... The catalytic efficiency and substrate specificity of PRTFDC1 was further characterized using a radiochemical assay with tritium-labeled bases as substrates, whereas the struc- tural basis for substrate ... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional...
Ngày tải lên: 15/02/2014, 01:20