Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog Yoichiro Abe1, Yoshiko Kita1and Takako Niikura 1,2 ,*1 Department of Pharmacology, ... suggestthat mammalian Gup1 acts as a negative regulator of the N-terminal palmitoylation of Shh.DiscussionIn this report, we found that mammalian Gup1, a mem-ber of the MBOAT superfamily bearing ... Petersburg,FL, USA) followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned...

Tài liệu Báo cáo khoa học: Post-translational modiﬁcation of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

... expected molecular mass of OTUB1 as well as the area above (rectangle) was excised and digested with trypsin. Digested material was analysed by a nano-LC Ion Trap mass spec-trometer. For the peptide ... immunoprecipitation of OTUB1. As a control, lysate was incubated with agarose without the antibody. Immunoprecipitatedmaterial was analysed by SDS ⁄ PAGE and silver staining, and the large band corresponding ... kinase interacts with a post-translationally modiﬁed form of OTUB1 that contains multiple phos-phorylation sites. OTUB1, YpkA and the small GTPase ras homologuegene family member A (RhoA) were...

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... s-DAPK-1Dtail was almost as active as full-length DAPK-1 (Fig. 4C). These data indicate that the‘tail’ of s-DAPK-1 has a negative regulatory functionwith regard to s-DAPK-1 activity, and that its ... integrin-mediated polarity pathway.J Cell Biol 172, 619–631.10 Inbal B, Bialik S, Sabanay I, Shani G & Kimchi A (2002) DAP kinase and DRP-1 mediate membraneblebbing and the formation of autophagic ... glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantiﬁcation in coloncarcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and...

Tài liệu Báo cáo khoa học: Endovanilloids Putative endogenous ligands of transient receptor potential vanilloid 1 channels docx

... G .A. , Finazzi-Agro, A. , Vliegenthart, J.F. & Maccarrone, M. (2002) Oxygenated metabolites of ana-ndamide and 2-arachidonoylglycerol: conformational analysis andinteraction with cannabinoid ... products of AAand anandamide to act as endogenous activators for TRPV1in vivo in light of the above mentioned criteria.N-arachidonoyldopamineBiosynthesisN-arachidonoyldopamine was characterized ... 10-fold more potent thananandamide and almost equipotent as capsaicin in somefunctional assays, with an EC50in Ca2+-inﬂux assays of approximately 50 nMat human and rat TRPV1 over-expressed...

Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx

... fromsulfonoquinovosyl diacylglycerols of sea urchin. Trans-plantation 74, 261–267.3 Mizushina Y, Watanabe I, Ohta K, Takemura M,Sahara H, Takahashi N, Gasa S, Sugawara F, Matsuk-age A, Yoshida S & Sakaguchi ... alga,Gigartina tenella. Chem Pharm Bull (Tokyo) 46, 684–686.5 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugaw-ara F, Matsukage A, Yoshida S & Sakaguchi K (1999)Action of a new mammalian ... of mammalian DNA polymerase alpha andbeta: sulfolipids from a pteridophyte, Athyrium niponi-cum. Biochem Pharmacol 55, 537–541.4 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugaw-ara F, Matsukage...

Tài liệu Báo cáo khoa học: Afﬁnity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

... two-exponential association model. kobs(rapid)and kobs(slow)are the observedassociation rate constants for the rapid and slow association phases, respectively. The values for the constants are means ... [125I]TC-PCSK9-D374Y thatremained bound after 6 h was about 45%. The dissoci-ation rate constants [koff] for the rapid phase [koff(rapid)]and for the slow phase [koff(slow)] are shown in Table 2.Taken ... KX) + plateau or the two-phaseexponential decay equation Y = plateau + Span-Fast*exp() KFastX) + SpanSlow*exp() KSlowX). The datawere also analyzed by plotting dissociation data accordingto...

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efﬁciency doc

... the Bradford assay with BSA as thestandard [28].Phytase activity assayPhytase activity was determined by measuring the amount of phosphate released from InsP6using a modiﬁed ferroussulfate ... expressionwas induced by addition of IPTG (1 mm) and Ca2+(1 mm) for 20 h at 20 °C. Culture supernatants and cell pelletswere assayed for phytase activity and separated by SDS ⁄PAGE.Puriﬁcation was ... was basically stable at 35 °C, and retained60% of the initial activity at 45 °C for 90 min whenassayed at 35 °C (Fig. 3A, B). The presence of Ca2+increased the thermal stability of PhyH and...

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable ... hence cannot accommo-date an electronegative atom. In contrast, the exocyclicN6-amino group of adenine forms a hydrogen bondwith the side chain of Asn 71, increasing the afﬁnity of RNase A for...

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... ACCCGATGATAGGCTTCY11 5A CGCTGGAAACCTCTTGG GCATCAACTTTCAAAAGATF127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT ... CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG ... GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... The catalyticefﬁciency and substrate speciﬁcity of PRTFDC1 wasfurther characterized using a radiochemical assay withtritium-labeled bases as substrates, whereas the struc-tural basis for substrate ... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... Y & Grubmeyer C (1998) Catalysis in human hypo-xanthine-guanine phosphoribosyltransferase: Asp 137 acts as a general acid ⁄ base. Biochemistry 37, 4114–4124.13 Balendiran GK, Molina JA,...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ