Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog Yoichiro Abe 1 , Yoshiko Kita 1 and Takako Niikura 1,2 , * 1 Department of Pharmacology, ... suggest that mammalian Gup1 acts as a negative regulator of the N-terminal palmitoylation of Shh. Discussion In this report, we fo...

Ngày tải lên: 18/02/2014, 16:20

... expected molecular mass of OTUB1 as well as the area above (rectangle) was excised and digested with trypsin. Digested material was analysed by a nano-LC Ion Trap mass spec- trometer. For the peptide ... immunoprecipitation of OTUB1. As a control, lysate was incubated with agarose without the antibody. Immunoprecipitated material was analysed by SDS ⁄ PAGE and silver staining,...

Ngày tải lên: 16/02/2014, 15:20

... s-DAPK-1Dtail was almost as active as full- length DAPK-1 (Fig. 4C). These data indicate that the ‘tail’ of s-DAPK-1 has a negative regulatory function with regard to s-DAPK-1 activity, and that its ... integrin-mediated polarity pathway. J Cell Biol 172, 619–631. 10 Inbal B, Bialik S, Sabanay I, Shani G & Kimchi A (2002) DAP kinase and DRP-1 mediate membrane blebbing and the...

Ngày tải lên: 18/02/2014, 17:20

... G .A. , Finazzi-Agro, A. , Vliegenthart, J.F. & Maccarrone, M. (2002) Oxygenated metabolites of ana- ndamide and 2-arachidonoylglycerol: conformational analysis and interaction with cannabinoid ... products of AA and anandamide to act as endogenous activators for TRPV1 in vivo in light of the above mentioned criteria. N -arachidonoyldopamine Biosynthesis N-arachidonoyldopamine...

Ngày tải lên: 19/02/2014, 12:20

... from sulfonoquinovosyl diacylglycerols of sea urchin. Trans- plantation 74, 261–267. 3 Mizushina Y, Watanabe I, Ohta K, Takemura M, Sahara H, Takahashi N, Gasa S, Sugawara F, Matsuk- age A, Yoshida S & Sakaguchi ... alga, Gigartina tenella. Chem Pharm Bull (Tokyo) 46, 684– 686. 5 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugaw- ara F, Matsukage A, Yoshida S & Sakaguchi K (1999) A...

Ngày tải lên: 19/02/2014, 17:20

... two-exponential association model. k obs(rapid) and k obs(slow) are the observed association rate constants for the rapid and slow association phases, respectively. The values for the constants are means ... [ 125 I]TC-PCSK9-D374Y that remained bound after 6 h was about 45%. The dissoci- ation rate constants [k off ] for the rapid phase [k off(rapid) ] and for the slow phase [k off(sl...

Ngày tải lên: 14/02/2014, 14:20

... the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... expression was induced by addition of IPTG (1 mm) and Ca 2+ (1 mm) for 20 h at 20 °C. Culture supernatants and cell pellets were assayed for phytase activity and separated by SDS ⁄ PAG...

Ngày tải lên: 14/02/2014, 15:20

... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank ... USA Introduction Upon catalyzing the cleavage of RNA, RNases operate at the crossroads of transcription and translation. Bovine pancreatic RNase A (EC 3.1.27.5) is the best...

Ngày tải lên: 14/02/2014, 22:20

... ACCCGATGATAGGCTTC Y11 5A CGCTGGAAACCTCTTGG GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT ... CCGTAGCACATGTCCA H428D AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V...

Ngày tải lên: 15/02/2014, 01:20

... The catalytic efficiency and substrate specificity of PRTFDC1 was further characterized using a radiochemical assay with tritium-labeled bases as substrates, whereas the struc- tural basis for substrate ... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional...

Ngày tải lên: 15/02/2014, 01:20