Tài liệu Báo cáo khoa học: Identiﬁcation, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila Sophie Sanchez, Ann C. Andersen, Ste´phane Hourdez and Franc¸ois H. LallierEquipe ... elegans, the fruitﬂies D. melanogaster and D. pseudoobscura, the mos-quitoes A. aegypti and A. gambiae, the clam T. gigas and larval sequences from the cnidarian F. scutaria. Finally, wechose an ... Bailly X & Lallier FH(2003) Expression and localization of carbonic anhydr-ase and ATPases in the symbiotic tubeworm Riftia pachyptila. J Exp Biol 206, 399–409.17 De Cian MC, Andersen AC,...

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... ACA G) and EWS reverse d(CGC TCG AGT CAC TAG TAG GGCCGA TCT CTG C), for pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC ... ssDNA S (lanes 1 and 2). The structures of DNAs used as probes are indicated above each lane. The DNA–protein complexes were resolved by 6% PAGE and visu-alized by autoradiography.K. Takahama ... (lanes 2 and 4) and 32P-labeled ETS-1(lanes 3 and 4) or ssDNA L (lanes 1 and 2). (B) EMSA was per-formed with EWS (lanes 2, 4 and 6) and 32P-labeled Htelo (lanes 3 and 4), dsHtelo (lanes 5 and...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC...

Tài liệu Báo cáo khoa học: Identiﬁcation of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,293–320.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis: a review of an important human ... Barenkamp SJ, Robbins JB, Tsai CM,Lim DJ & Battey J (1998) Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... P(2000) The transcriptional co-activator P ⁄ CAF potenti-ates TGF-beta ⁄ Smad signaling. Nucleic Acids Res 28,4291–4298.39 Kahata K, Hayashi M, Asaka M, Hellman U,Kitagawa H, Yanagisawa J, Kato ... DeMarco R, Martins EA,Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP,Nishiyama MY Jr, Kitajima JP, Adamson RE et al.(2003) Transcriptome analysis of the acoelomate humanparasite Schistosoma ... R-Smads, such as a nuclear localization signal and a DNA-binding domain in the MH1 domain and the L3 loop, and the C-terminal, receptor phos-phorylation motif in the MH2 domain (Fig. 1A) . The amino...

Tài liệu Báo cáo khoa học: Identiﬁcation of differentially expressed genes of the Paciﬁc oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 ... kinasecomplex-associated proteinAAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine synthetase ACGGAGGTTGACGGGACTTGCTGGCACCACGATTGGDelta-9-desaturase ... CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of kappa light polypeptide enhancer...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... intensity of the immunoreactive band in the HMW region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... found to have a molecular mass of 64 kDa, and to containtwo tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involvedin...

Tài liệu Báo cáo khoa học: Identiﬁcation of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- and C-terminal sequences of b-amyrin synthase from ... for soyasapogenol A is not as simple as that for soyasapogenol B, and the presence of additional hydroxylases must beconsidered. Fortunately, the aglycone of the majorsoyasaponins is soyasapogenol ... pattern wasalso identical to that of the authentic olean-3b,24-di-acetoxy-12-ene, except for the presence of several back-ground peaks (the amount of authentic sample wasadjusted to equalize the...

Tài liệu Báo cáo khoa học: Identiﬁcation of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... [3,4].Arguably the most notable of these cascades is the Janus kinase (Jak)-signal transducer and activator of transcription (STAT) pathway that regulates the transcription of numerous IFN-sensitive ... activation in the absence of the STAT2 DNA binding domain as determined by Affymetrix DNA microarrayanalysis. Total mRNA samples from U 6A- 2, U 6A- 2VV-II and U 6A cells either left untreated or treated ... IFN-regulated genes in the absence of the STAT2 DNAbinding domain, we treated U 6A, U 6A- 2 and U 6A- 2VV-II cells with IFN-alfacon-1 for 6 h and analyzedgene expression using relative quantitative real-timePCR....

Tài liệu Báo cáo khoa học: Identiﬁcation of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... sense5¢-UCAUCACACUGAUAACCAACACUGA-AG-3¢;#2578,sense 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢; and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAGUUCUG-AG-3¢. The forward sequence of the scrambledRNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAGAG-3¢. ... with the antimatriptase antibody M32. The bar indicates a gelatinolytic bandat approximately 80 kDa in lane 1 and a matriptase band at almost the same position in lane 2. Other experimental conditions ... in the two-conditioned media was separated to a single band of 33 kDa (data not shown), indicating that the cleavedIGFBP-rP1 was a two-chain form consisting of a 25 kDa chain and an 8 kDa chain...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ