Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Journal compilation ª 2007 FEBS Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP 1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting ... mitochondrial targeting of CYP2E1 Naresh B. V. Sepuri, Sanjay Yadav, Hindupur K. Anandatheerthavarada and Narayan G....

Ngày tải lên: 18/02/2014, 16:20

... resultant binding and selective alkyla- tion leading to a depletion of mtDNA in intact cells (Fig. 1). Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating ... Biotech). MtDNA was prepared from isolated rat liver mitochon- dria (40 mg protein) using a plasmid spin miniprep kit (Qiagen) at a ratio of 5 mg mitochondrial prot...

Ngày tải lên: 20/02/2014, 11:20

... FEBS 3759 Introduction C-peptide is derived from most of the proinsulin seg- ment in between the B and A chains of insulin [1] and has an important structural role in the proper folding and disulfide ... observation that self-asso- ciating peptides and proteins are at the core of several neurodegenerative diseases has led to a massive effort aiming to understa...

Ngày tải lên: 18/02/2014, 04:20

... Barenkamp SJ, Robbins JB, Tsai CM, Lim DJ & Battey J (199 8) Synthesis and characteriza- tion of lipooligosaccharide-based conjugates as vaccine candidates for Moraxella (Branhamella) catarrhalis. Infect ... study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19] Kan FP CTC ATC GAG CAT CAA ATG (kanamycin antisense) [19] Identification of M. catarrhalis lpxX and lpxL S. Gao e...

Ngày tải lên: 18/02/2014, 14:20

... for the attachment, capture and destruction of invading microorganisms. The NETs contain nuclear materials that include DNA and bactericidal proteins and histone-derived peptides such as buforins ... nonpeptides H4-(86–10 0) and HNr (Fig. 1) were tested for their bactericidal activity against Gram-negative and Gram- positive bacteria (Table 1). The bactericidal act...

Ngày tải lên: 18/02/2014, 14:20

... sequences yef1-attB1FSD AAAAAGCAGGCTCC GAAGGAGATATAAAA ATGAAAACTGATAGATTACTG yef1-attB2R AGAAAGCTGGGTG GATTGCAAAATGAGCCTGAC attB1 ACAAGTTTGTACAAAAAAGCAGGCT attB2 ACCACTTTGTACAAGAAAGCTGGGT yef1hisf CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC yef1hisr GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG pos5hisf CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGC...

Ngày tải lên: 20/02/2014, 01:20

... recent advances on the biochemical and structural characterization of the proteins involved in translocon formation, as well as their participation in the modi- fication of intracellular signalling ... membrane proteins (the hydropho- bic translocators) and one hydrophilic partner (also called the V antigen in Pseudomonas aeruginosa and Yersinia spp.; Figs 1 and...

Ngày tải lên: 14/02/2014, 22:20

... Ltd. The targeting sequence of the siRNA against rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT-3¢. A negative control adenovirus vector containing nonspecific siRNA was constructed in the same way (non- specific ... protein 1 (TRAP 1) is a mito- chondrial chaperone that plays a role in maintaining mitochondrial func- tion and regulating cell apoptosis. The opening of...

Ngày tải lên: 16/02/2014, 14:20

... adenylate kinase to prevent depletion of available ATP and ADP and to maintain steady-state respiration. Instead, we did a theoretical calculation of the extramitochondrial AMP concentra- tion ([AMP] out ) ... (5 and 10 lm) affects the ATP total ⁄ ADP total ratio and [AMP] total in actively phosphorylating (state 3) mitochondria respir- ing on succinate and comp...

Ngày tải lên: 19/02/2014, 05:20

... The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) Prasanth Potluri, Nagendra Yadava and Immo ... Inspection of the amino acid sequences of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembra...

Ngày tải lên: 19/02/2014, 16:20