Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Journal compilation ª 2007 FEBS Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP 1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting ... mitochondrial targeting of CYP2E1 Naresh B. V. Sepuri, Sanjay Yadav, Hindupur K. Anandatheerthavarada and Narayan G....

Ngày tải lên: 18/02/2014, 16:20

16 651 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... resultant binding and selective alkyla- tion leading to a depletion of mtDNA in intact cells (Fig. 1). Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating ... Biotech). MtDNA was prepared from isolated rat liver mitochon- dria (40 mg protein) using a plasmid spin miniprep kit (Qiagen) at a ratio of 5 mg mitochondrial prot...

Ngày tải lên: 20/02/2014, 11:20

10 639 0
Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx

... FEBS 3759 Introduction C-peptide is derived from most of the proinsulin seg- ment in between the B and A chains of insulin [1] and has an important structural role in the proper folding and disulfide ... observation that self-asso- ciating peptides and proteins are at the core of several neurodegenerative diseases has led to a massive effort aiming to understa...

Ngày tải lên: 18/02/2014, 04:20

10 562 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Barenkamp SJ, Robbins JB, Tsai CM, Lim DJ & Battey J (199 8) Synthesis and characteriza- tion of lipooligosaccharide-based conjugates as vaccine candidates for Moraxella (Branhamella) catarrhalis. Infect ... study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19] Kan FP CTC ATC GAG CAT CAA ATG (kanamycin antisense) [19] Identification of M. catarrhalis lpxX and lpxL S. Gao e...

Ngày tải lên: 18/02/2014, 14:20

14 675 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... for the attachment, capture and destruction of invading microorganisms. The NETs contain nuclear materials that include DNA and bactericidal proteins and histone-derived peptides such as buforins ... nonpeptides H4-(86–10 0) and HNr (Fig. 1) were tested for their bactericidal activity against Gram-negative and Gram- positive bacteria (Table 1). The bactericidal act...

Ngày tải lên: 18/02/2014, 14:20

12 756 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

... sequences yef1-attB1FSD AAAAAGCAGGCTCC GAAGGAGATATAAAA ATGAAAACTGATAGATTACTG yef1-attB2R AGAAAGCTGGGTG GATTGCAAAATGAGCCTGAC attB1 ACAAGTTTGTACAAAAAAGCAGGCT attB2 ACCACTTTGTACAAGAAAGCTGGGT yef1hisf CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC yef1hisr GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG pos5hisf CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGC...

Ngày tải lên: 20/02/2014, 01:20

13 560 0
Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf

Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf

... recent advances on the biochemical and structural characterization of the proteins involved in translocon formation, as well as their participation in the modi- fication of intracellular signalling ... membrane proteins (the hydropho- bic translocators) and one hydrophilic partner (also called the V antigen in Pseudomonas aeruginosa and Yersinia spp.; Figs 1 and...

Ngày tải lên: 14/02/2014, 22:20

13 648 0
Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

... Ltd. The targeting sequence of the siRNA against rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT-3¢. A negative control adenovirus vector containing nonspecific siRNA was constructed in the same way (non- specific ... protein 1 (TRAP 1) is a mito- chondrial chaperone that plays a role in maintaining mitochondrial func- tion and regulating cell apoptosis. The opening of...

Ngày tải lên: 16/02/2014, 14:20

10 507 0
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

... adenylate kinase to prevent depletion of available ATP and ADP and to maintain steady-state respiration. Instead, we did a theoretical calculation of the extramitochondrial AMP concentra- tion ([AMP] out ) ... (5 and 10 lm) affects the ATP total ⁄ ADP total ratio and [AMP] total in actively phosphorylating (state 3) mitochondria respir- ing on succinate and comp...

Ngày tải lên: 19/02/2014, 05:20

15 547 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) Prasanth Potluri, Nagendra Yadava and Immo ... Inspection of the amino acid sequences of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembra...

Ngày tải lên: 19/02/2014, 16:20

9 623 0
w