Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

... PC1 ⁄ 3, PC2 and PC5 ⁄ 6A are targeted to dense core secretory granules by a common mechanism Jimmy D. Dikeakos 1 , Chantal Mercure 1 , Marie-Jose ´ e Lacombe 1 , Nabil G. Seidah 2 and Timothy ... ª 2007 FEBS is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, histidine and serine, and a st...

Ngày tải lên: 18/02/2014, 16:20

... disease. Lancet Neurol 7, 97–109. 4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai- to M, Maruyama M, Takahashi T, Ozawa T, Tsuji S & Takahashi H (2000) An autopsy case of autosomal- recessive ... Specifically, this association is mediated by pathogenic DJ-1 mutations and oxidative stress [76]. These data suggest a link DJ-1 and Parkin in a common pathway in mammals. A...

Ngày tải lên: 18/02/2014, 14:20

... 5¢-GACGAAATGACTGTTTCTTT GAGCC TTTTCGTACCCC-3¢; (d) COX-2 promoter Ets site #4, 5¢-AGGGGAGAGGAGGG TTAAATTTGTGGGGGGTA CGAAAAGGCGG-3¢; (e) COX-2 promoter Ets site #5: 5¢-GGGTTTTTTACCCACG CTAATGAGAAAATCGGAA ACC-3¢. DNA ... expression by CpG DNA: role of NF-kappaB and p38. J Biol Chem 278, 22563– 22573. 15 Teruyama K, Abe M, Nakano T, Iwasaka-Yagi C, Takahashi S, Yamada S & Sato Y (2001) R...

Ngày tải lên: 19/02/2014, 17:20

... using an ECL kit. For densitometric analysis, data were captured using a Fuji LAS-1000 Imaging System CCD camera (aida 2.11 soft- ware for analysis). ACE2 ⁄ ACE activity assays Fluorogenic assays ... bicincho- ninic acid assay with BSA as standard [30]. PNGase F treatment PNGase F treatment (New England Biolabs, Beverly, MA, USA) was performed according to the manufacturer’s instructions....

Ngày tải lên: 20/02/2014, 01:20

... [30] to obtain cDNAs encoding M25L–elafin and M63L–trap- pin. For this purpose, forward primers 5¢-CGACTCGA GAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGAC TCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ were used for amplification ... NE and Pr3 by native and oxidized elafin and trappin NE and Pr3 are both able to solubilize fibrous elastin [19]. We used remazol-Brilliant Blue (RBB)–elastin to in...

Ngày tải lên: 19/02/2014, 07:20

... an exciting area of research and poten- tially a therapeutic avenue to treat obese and diabetic people. Manipulating metabolic pathways for the treat- ment of disease has once again placed basic ... Thus, the brain can directly sense and respond to changes in nutrient availability and composition to affect body weight and adiposity. Abbreviations ACC, acetyl-CoA carboxylase;...

Ngày tải lên: 14/02/2014, 22:20

... bound to pantoate Cocrystallization trials of nPS with pantoate were performed over a range of pantoate concentrations. Crystals of the nPS–pantoate complex obtained at 50 mm pantoate diffracted to ... to a network of water molecules that are hydrogen-bonded to the O1 atom of pantoate in site I. The O4 atom of pantoate in site II and the O1 atom of pantoate in site I are hyd...

Ngày tải lên: 16/02/2014, 09:20

... that both VP2 and VP3 kill cells comparably fast and effi- ciently and are associated not only with a damaged ER, but also with mitochondrial and other intracellu- lar membranes. The observed association ... caspase 3 activity and the caspase inhibition assay At indicated time-points, cell lysates were prepared and tested for cleavage of amino acid DEVD sequences by cas- pase...

Ngày tải lên: 16/02/2014, 09:20

... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC SGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT SGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT ATH1_suc2 ... GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG R1_pLC1 TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC PEP4_D CAGAGAAAC...

Ngày tải lên: 18/02/2014, 06:20

... biochemical modulators and proin- flammatory factors contributing to systemic and peripheral vascular inflammation. These include inter- leukin (IL)-6, IL-1b, plasminogen activator inhibitor-1 (PAI-1), ... conclusions Visceral obesity, in particular, is characterized by increased inflammatory factors, decreased plasma TT levels and endothelial dysfunction. Obesity is associ- ated with...

Ngày tải lên: 18/02/2014, 06:20