Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Catlin BW (1990) Branhamella catarrhalis: an organism gaining respect as a pathogen. Clin Microbiol Rev 3, 293–320. 2 Karalus R & Campagnari A (2000) Moraxella catarrh- alis: a review of an ... AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) This study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19] Kan FP CTC ATC GAG CAT CAA AT...

Ngày tải lên: 18/02/2014, 14:20

14 675 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... C), for pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA ... protein as a G-quadruplex DNA- and RNA-binding protein Kentaro Takahama 1, *, Katsuhito Kino 2, *, Shigeki Arai 3 , Riki Kurokawa 3 and Takanori Oyoshi 1 1 Department of Chemistry, Faculty...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA HYPK GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA HSP70 TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG Heat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT HSP23 ... in B cells, kinase complex-associated protein AAAGCAGAGCAGAAAAAGTGGAA GGACAATGCCGCGATCAG Non-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACA GGGATGGAGGGT...

Ngày tải lên: 18/02/2014, 16:20

11 571 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... M, Hasegawa K, Horita C & Akera S (1999) A new matrix protein family related to the nacreous layer formation of Pinctada fucata. FEBS Lett 462, 225–229. 5 Kono M, Hayashi N & Samata T ... 126, 511–520. 27 Tohse H, Murayama E, Ohira T, Takagi Y & Nagasa- wa H (2006) Localization and diurnal variations of car- bonic anhydrase mRNA expression in the inner ear of the rainbow...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... cerevisiae strain GIL77 Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAG GTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCA AAGGAACTCTTCT-3¢), corresponding to the N- and C-terminal sequences of b-amyrin synthase from ... Cloning and characterization of a cDNA encod- ing b-amyrin synthase involved in glycyrrhizin and soyasaponin biosynthesis in licorice. Biol Pharm Bull 24, 912–916. 16 Hayashi H,...

Ngày tải lên: 19/02/2014, 07:20

12 705 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... in the absence of the STAT2 DNA binding domain as revealed by real-time PCR To more quantitatively examine the expression of IFN- regulated genes in the absence of the STAT2 DNA binding domain, ... on a functional STAT2 DNA binding domain do not appear to play an important role in mediating the transcription of these genes. The c-fos gene was examined in this system as a...

Ngày tải lên: 19/02/2014, 07:20

13 460 0
Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢; and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAG UUCUG-AG-3¢. The forward sequence of the scrambled RNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAG AG-3¢. OVISE cells were plated the day before ... The main fraction contained a 75 kDa matriptase as a major component and a few contamin- ating proteins as analyzed by SDS ⁄ PAGE. RNAi experiments with OVISE cells Matript...

Ngày tải lên: 19/02/2014, 07:20

13 603 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

... ACCACTTTGTACAAGAAAGCTGGGT yef1hisf CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC yef1hisr GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG pos5hisf CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC pos5hisr CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAATCGATGAATTCGAGCTCG pos5leu21.6f CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCCAATTCTGTGTTTCCCGGAAATG p...

Ngày tải lên: 20/02/2014, 01:20

13 560 0
Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... therefore provide additional critical infor- mation over that obtained from X-ray data alone. The knowledge gained from these mutagenesis data will be valuable in directing the design of modulators ... side chain of Arg273 is therefore crit- ical for binding of the substrate. Maintaining the posit- ive charge at this position (R273K) is not sufficient for docking of the peptide i...

Ngày tải lên: 20/02/2014, 01:20

9 789 2
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

... auto- radiographed. In the UV cross-linking assay, the samples were incuba- ted at room temperature, as described above for the EMSA assay, and then irradiated at 302 nm for 10 min using a transilluminator ... different isoforms of eEF 1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers Barbara Dapas 1 , G...

Ngày tải lên: 21/02/2014, 00:20

12 552 0
w