Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different ﬂanking bases preference pptx

... The Authors Journal compilation ª 2009 FEBS Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different ... M,Yamaguchi-Shinozaki K & Shinozaki K (1998)Two transcription factors, DREB1 and DREB2, with an EREBP ⁄ AP2 DNA binding domainseparate two cellular signal transduction pathwaysin drought- and low-temperature-responsive ... withinthe AtERF family recognize a certain binding site with universal binding characteristic to a conserved core. The divergent short ﬂanking bases, on the other hand,allow preference to govern differential...

Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

... cleavetheir substrates after paired basic amino acids, and theyare known to participate in the proteolytic activation of a variety of hormones, growth factors, enzymes, recep-tors and viruses, either ... proteases that cleave their substrates at basic amino acids,thereby activating a variety of hormones, growth factors, and viruses.PC1 ⁄ 3, PC2 and PC5 ⁄ 6A are the only members of the PC family ... C-terminal domains of PC1 ⁄ 3, PC2 and PC5 ⁄ 6A conﬁrmed thatall three domains have the capacity to redirect a constitutively secreted pro-tein to the granule-containing cytoplasmic extensions. Analysis...

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAAGTTAGAACT-3¢Reverse: 5¢-TAGCGGCCGCTTACTTTGGGTTAACGACGGA-3¢Mutant MPHbG194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢G198P 5¢-AAAGGTTTCTTCAAGCCGGCCATGGCTTCCCTT-3¢G194P ... Each test wascarried out with at least three replicates. The Km and kcatval-ues were calculated by nonlinear regression using graphpadprism 5.0 (GraphPad Software Inc., La Jolla, CA, USA).Thermostability ... Gribenko AV, Patel MM, Liu J, McCallum SA, WangC & Makhatadze GI (2009) Rational stabilization ofenzymes by computational redesign of surface charge-charge interactions. Proc Natl Acad Sci USA...

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding speciﬁcity pdf

... pyloriCCUG17874 genomic DNA using the following primers:forward, 5¢-CACCAAACCTTATACGATTGATAAGGCAAAC-3¢; and reverse, 5¢-TTATTATTGGGCGTAAGCTTCTAG-3¢. The construct was cloned directly into thepET151 ... [3]. Majorvirulence factors that contribute to the inﬂammatoryresponse and to epithelial cell damage have been iden-tiﬁed, among them cytotoxin-associated gene protein A [4,5], vacuolating toxin ... that erucamide was present as a contaminant inplastic material and was taken up by the protein dur-ing some puriﬁcation step. The latter event appears to be quite unlikely, as we have to assume...

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... required. The available dataindicate that the accessory factor Bcs1p is involved inthe binding of ISP to an immature bc1intermediate[28,29] and that Cbp3p and Cbp4p play an essential,but poorly ... and 2) and DQCR9 (lanes 3 and 4) yeast strains weresolubilized with 1% digitonin (lanes 1 and 3) or 1% Triton X-100(lanes 2 and 4) and protein complexes were analyzed by BN ⁄ PAGE,as described ... 3329–3330.45 Ito H, Fukuda Y, Murata K & Kimura A (1983)Transformation of intact yeast cells treated with alkalications. J Bacteriol 153, 163–168.46 Scha¨gger H & von Jagow G (1991) Blue native...

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

... disease. Lancet Neurol 7,97–109.4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai- to M, Maruyama M, Takahashi T, Ozawa T, Tsuji S &Takahashi H (2000) An autopsy case of autosomal-recessive ... cell-signalling cascades including MAPK and phosphatidylinositol3-kinase (PI3K) pathways that can target HtrA2, PINK1, Parkin and DJ-1. Likely these PD-associated proteins are part of a complexnetwork ... Speciﬁcally, this association ismediated by pathogenic DJ-1 mutations and oxidativestress [76]. These data suggest a link DJ-1 and Parkin in a common pathway in mammals. A described case ofautosomal-recessive...

Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

... (Bio-source International, Camarillo, CA, USA) to detectactive Akt kinase, as well as a separate Akt polyclonalantibody (Cell Signaling Technology, Danvers, MA, USA) to determine total Akt, as described ... of platelets[26]. The current data indicate that ADP, acting viaP2Y12 and Gi, can down-regulate adenylyl cyclase and hence PKA with consequently increasedCa2+mobilization. This pathway still ... situby activation of PRP with tissue factor and CaCl2,the P2Y12⁄ PI3-K pathway signiﬁcantly enhances theactivation state and, hence, the procoagulant activityof platelets. Experiments with...

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

... The Authors Journal compilation ª 2007 FEBSforms of X-linked mental retardation [4]. In addition, a number of bacterial virulence factors and toxins havebeen found to target Rho GTPases and to ... panel). HEK293 cells were transfected with a combination of expression plasmids of HA–Rac1L61, HA–Rac1bWT, HA–Rac1bL61 and 6His–myc–Ub as indicated. Proteasomal degradation of Rac1L61 and Rac1b ... to a local pertur-bation of Lys147 (Lys166 in Rac1b), and nor does itseem to be related to a defective interaction with plasma membrane, as Rac1b was found to be mostlyassociated with plasma...

Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt

... membrane ofGram-negative bacteria. It activates monocytes and macrophages to produce cytokines such as tumor necrosis factor- a and interleukins IL-1b and IL-6. These cytokines appear to be ... bacteria, and its recognition and signal transmission are key events in the host defensereaction towards Gram-negative bacteria. Generally,LPS activates monocytes and macrophages to producecytokines ... Bedford,MA, USA) using a transfer apparatus at 0.35 mA for2.5 h. The membrane was then blocked with 5% nonfatmilk and incubated with primary antibody against ICAM-1(anti-mouse, 1 : 500; BD Pharmingen,...

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. ... primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ... residues to Ala wascarried out using the QuickChange kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢...

Xem thêm

Từ khóa: tài liệu bảo hiểm đại học tài liệu về nhà khoa học vật lý tài liệu về môn khoa học quản lý tài liệu thi môn khoa học quản lý tài liệu nhập môn khoa học giao tiếp khái niệm tài liệu lưu trữ khoa học kỹ thuật Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ