Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing Ali Tadlaoui ... participates in growth regulation of human breast carcinoma cells. Oncogene 20, 249 9–2 5 13. 9 Kanda N, Seno H, Konda Y, Marusawa H,...

Ngày tải lên: 18/02/2014, 08:20

... reverse-joined hairpin ribozymes that are structurally optimized and which, in addition to cleavage, catalyse efficient RNA ligation. The most efficient variant ligated its appropriate RNA substrate with a ... clipping of a fragment of desired length and sequence from a nat- ural RNA may be a useful application. For example, RNA fragments that involve modified nucleobases...

Ngày tải lên: 20/02/2014, 01:20

... large-scale distribu- tional semantics (Bhagat and Ravichandran, 2008; Van Durme and Lall, 2009; Pantel et al., 2009; Lin et al., 2010; Goyal et al., 2010; Bergsma and Van Durme, 2011), as well as large-scale ... reser- voirs, and a 32 bit integer to track n. This is com- pared to b 32 bit floating point values, as is standard. Note that our scheme comes away with similar lev- el...

Ngày tải lên: 20/02/2014, 04:20

... amplified from the pSPORT-AeaAQP by PCR using two primers: AeapS1F, 5¢-GGAAGATCTATGACTGAAAGCG CA -3 ; AeapS1R, 5¢-GGAAGATCTTTAAAAATCGTA AGATTCC -3 . The PCR primers contain BglII restriction sites ... region of AeaAQP was amplified from the pSPORT-AeaAQP [22] by thermal cycling using AeaS1F and AeaS1RprimersandclonedintopXbG-ev1asdescribed in Materials and methods. Fig. 3. AeaAQP fun...

Ngày tải lên: 20/02/2014, 23:20

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_0011 136 53 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_0011 136 53 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a...

Ngày tải lên: 14/02/2014, 14:20

... (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 97 7–9 83. 31 Matsui H, Miyao A, Takahashi A & Hirochika H (2010) Pdk1 kinase regulates basal disease resistance through ... buffer and [c- 32 P]-ATP. MBP was used as an artifi- cial substrate to assess the kinase activity and GST alone was used as a negative control. The top panel shows the kina...

Ngày tải lên: 14/02/2014, 19:20

... cellular retinaldehyde-binding protein. After 2 h of incuba- tion at 37 °C in the dark, the generated retinoids were extracted with 30 0 lL of methanol and 30 0 lL of hexane and analyzed by normal-phase ... Proc Natl Acad Sci USA 84, 184 9– 18 53. 26 Barry RJ, Canada FJ & Rando RR (1989) Solubiliza- tion and partial purification of retinyl ester synthetase and re...

Ngày tải lên: 18/02/2014, 08:20

... vector via two engineered restriction sites (NdeI and EcoRI) introduced by PCR with the primers 5¢-GCTATTGTGGTAGAATA CATATG AGACAC -3 , sense, and 5¢-GGAGTTGTAAAAATTC GAATTCTAAAGAGC -3 , antisense ... N-ribo- hydrolase): functional complementation by a nucleoside hydrolase from a protozoan parasite and by a mamma- lian uridine phosphorylase. Appl Environ Microbiol 68, 133...

Ngày tải lên: 18/02/2014, 17:20

... ABCG2 R482G . (A) Purified ABCG2 R482G (0.25 lg) was photolabelled with [a 32 P]azido-ATP (3 30 0 lM) as described in Materials and methods. Labelled protein was visualized and quantified by autoradiography of ... 275 30 0. 2 Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan I & Gottesman MM (1999) Biochemical, cellu- lar, and pharmacological aspects of the multidrug t...

Ngày tải lên: 18/02/2014, 18:20

... (underlined) and had the sequence 5¢-gacatca aagcttATGGATAAAGCCATT CAGCATCCT -3 , and the 3 primer had a XhoI restriction site (underlined) and the sequence 5¢-aag ctcgagTTAGACA TTCACAGGAGGGTGGTT -3 . ... primer 5¢-TGGGTATGGAGTCCTGTGGT and reverse primer 5¢-AGACAGCACTGTGTTGGCATA. In the analysis of Y 2 and Y 7 gene expression, actin was amplified using forward primer 5¢-AATCAAGA...

Ngày tải lên: 19/02/2014, 07:20