Tài liệu Báo cáo khoa học: Evidence that the assembly of the

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... bc 1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc 1 complex that ﬁnally ... respiratory chain, the assistance of speciﬁc chaperone proteins is also required. The available data indicate that the accessory factor Bcs1p is involved in...

Ngày tải lên : 18/02/2014, 08:20

15
639
0

Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... for the a domain are larger than those for the b domain. Further interpretation of these data resulted in the proposal of positively cooperative metal binding as the primary metallation mechanism ... domain of human MT- 1a [29] showed that the single remaining metal ion in the demetallation reaction was the C-terminal metal ion, indicating that occupancy of th...

Ngày tải lên : 19/02/2014, 00:20

9
533
0

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... gctttttggcaccaaagccctcggctccatcgg Lys24 to Ala L2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to Ala G3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to Ala F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... Ala P2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to Ala L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala 2R > N R37N F gtagcgggctggattaacgcgttgaatt...

Ngày tải lên : 19/02/2014, 17:20

15
532
0

Tài liệu Báo cáo khoa học: Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies pdf

... formation assay. Table 2 shows the percentage of G418- resistant colonies obtained by transfecting the established human tumor pancreatic carcinoma MIA PaCa 2 and the breast adenocarcinoma MDA-MB-231 ... functions as a molecular switch in a large network of signaling pathways [1]. Mutations in the ras gene have been identiﬁed in about 30% of all human cancers, indi...

Ngày tải lên : 21/02/2014, 00:20

9
624
0

Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx

... autophosphorylating ability o f PknA is strictly magnesium/manganese-dependent, and sodium orthovanadate can inhibit this activity. Phosphoamino-acid analysis ind icated that PknA phosphorylates at serine and threonine ... lunt-ended fragment was cloned at the SmaI site of pUC19 (pPknA). Plasmid DNA was prepared after transform ation of pPknA in E. coli strain DH 5a and sequenced...

Ngày tải lên : 22/02/2014, 04:20

8
428
0

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... coenzyme analog lacking the adenine ring in the upper axial ligand; a model of damaged cofactors) for free adeninylpentylcobalamin (AdePeCbl) (an inactive coenzyme analog containing the adenine ring ... 11 A ˚ in height. The size of this cavity is comparable with that of adenine- lacking cobalamins, and thus allows the damaged cofactor to pass through it. Intact co...

Ngày tải lên : 15/02/2014, 01:20

13
620
0

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealing because of the presence of a putative nucleotide-binding motif in the N-terminal of the protein sequence and ... encodes a ( 42 kDa) protein that has an N-terminal signal sequence suggestive of a location in the periplasm. On the other hand, in Ps. aeruginosa...

Ngày tải lên : 15/02/2014, 01:20

12
613
0

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... defective at cleaving a substrate involved in the activation of the Nlrp1b in ammasome. Abbreviations ERK, extracellular signal-related kinase; HA, hemagglutinin; IL, interleukin; JNK, c-Jun N-terminal ... of amino acids that has previously been implicated in binding MAPKKs [22]. Glu682 is within an a- helix that also contains the amino acids A B Fig. 1. An LF double m...

Ngày tải lên : 16/02/2014, 09:20

9
579
0

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic site at the interface of the two domains [4,5]. HAPs can initi- ate hydrolysis of phytate at either the C 3 (EC ... smaller than for AppA, showing that binding is favored by the preformed site. By con- trast, catalysis by AppA is faster, as reﬂected in the values for k cat ⁄ K...

Ngày tải lên : 16/02/2014, 09:20

13
766
0

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed to introduce ... EXAFS analysis that the Fe 2+ cofactor is coordi- nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or an aspartate. The apparent conﬂict...

Ngày tải lên : 18/02/2014, 06:20

15
624
0