Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes Stan Stasinopoulos 1 , Mythily Mariasegaram 1 , Chris Gafforini 1 , ... CTTTGTTATTTATTAT GCATTCCTATGGTGAGTT Forward (nt 15 52 1585 PAI -2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–15 52 PAI -2) SJS261 CTTTGT...

Ngày tải lên: 16/02/2014, 09:20

... CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGC PEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC SGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT SGA1_R ... TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC HA_D ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG HA_R CAAAGCGATCTTATTCTTTT AGCGTAATCTGGAACGTC ATH1_1 AC...

Ngày tải lên: 18/02/2014, 06:20

... literature: the dominant polymorph a- chitin (antiparallel packing of the chitin chains); b-chitin (parallel packing of the chitin chains); and the minor polymorph c-chitin (mixture of parallel and antiparallel ... )2. G. Vaaje-Kolstad et al. L. lactis chitinase and chitin-binding protein FEBS Journal 27 6 (20 09) 24 02 24 15 ª 20 09 The Authors Journal compilation ª 20...

Ngày tải lên: 18/02/2014, 08:20

... 3B). Ala21 mainly follows the same pattern as Ala2 in Ab(1–9). The other residues show a minimum / angle at 10–15 °C, after which they return towards a random coil average. The two phenylalanines ... similar to residues 2 8, whereas Ala21 goes directly from PII-rich state to random coil. Val18, Phe19, Phe20 and Val24 on the other hand seem to start in a b-strand-ric...

Ngày tải lên: 20/02/2014, 01:20

... i) the structure of the task that the user is trying to accomplish and the user's goals and plans arising from the task; 2) the strategies available to the user when the user is unable to ... users' and adviser's plans and goals. BOUNDARY MARKERS The analysis of boundary markers revealed reliable indicators at the opening of subdialog...

Ngày tải lên: 21/02/2014, 20:20

... (tissue-type- and urokinase-type plasminogen activator; tPA, uPA) were in turn specifically inhibited by plasminogen activator inhibitors (PAIs)-types 1 and 2, both of which belong to the serine protease inhibitor (serpin) ... Hofmann GE, Glatstein I, Schatz F, Heller D & Delig- disch L (1994) Immunohistochemical localization of urokinase-type plasminogen activator...

Ngày tải lên: 20/02/2014, 02:21

... InsP 6 gradually into InsP 5 , InsP 4 , and the final product – Ins (2, 4,6)P 3 and Ins(1,3,5)P 3 – via two alternative pathways [14]. Bacterial BPPs containing two tandemly repeated domains (dual domains) ... they can increase the amount of available phosphate by interacting together. Additionally, fusing PhyH-DI to a single-domain phytase appears to be an efficient way to...

Ngày tải lên: 14/02/2014, 15:20

... 1 425 . 39 Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa U & Yasuda T (20 02) Activation of AtMEK1, an Ara- bidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active ... or HIS-PTI1-4 (PTI) in kinase buffer and [c- 32 P]-ATP. For (A) and (B) the top panel shows the kinase assay visualized by autoradiography and the bottom panel s...

Ngày tải lên: 14/02/2014, 19:20

... Caenor- habditis elegans synMuvB proteins and is composed of p130, E2F4 ⁄ 5 and DP1 ⁄ 2 and a module containing the MuvB proteins Lin-37, Lin- 52, Lin-54 and chromatin- associated Lin-9 and Lin-53 ... CDE acts as an activating element binding E2F1, -2 and -3. These acti- vating E2Fs cooperate with NF-Y proteins binding to CCAAT-boxes and with Myb proteins associat...

Ngày tải lên: 16/02/2014, 09:20

... reagents and the recombinant human TRAIL ⁄ APO 2 ligand were purchased from Invitrogen and Feldan Bio (St-Laurent, QC, Canada), respectively. The caspase 3 substrate (Ac-DEVD-pNA) and the inhibitor substrate ... 1 329 membrane to induce apoptosis. J Biol Chem 27 7, 122 37– 122 45. 24 Azakir BA & Angers A (20 09) Reciprocal regulation of the ubiquitin ligase Itch...

Ngày tải lên: 16/02/2014, 09:20