Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf
... An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy MogridgeDepartment of Laboratory ... has been shown previously that inhibition of the ERK pathway is sufficient toinduce apoptosis. It is unclear why the mutant is defec-tive at causing pyroptosis, but it is presumably becauseLF-K518E ... a mutant that was defective at killing RAW 264.7 cells (data not shown).One of the identified mutants contained two substitu-tion mutations, K518E and E682G (Fig. 1A). Lys518 is within a patch...
- 9
- 579
- 0
Tài liệu Báo cáo khoa học: An investigation of the substrate specificity of the xyloglucanase Cel74A from Hypocrea jecorina pdf
... intermediate product(Fig. 5) confirms that the substrate is not hydrolyzedto its repeating unit XXXG. Moreover, it can be con-cluded that Cel74A is not able to hydrolyze xyloglucan at unbranched ... general degradation, presumably by con-taminating enzyme activities. Nevertheless, this sub-strate mixture is still very useful for the qualitativeanalysis of the degradation pattern, and will ... using xyloglucan oligosaccharides. In thisarticle, hydrolysis at substituted Glc residues is clearlydemonstrated, and a new interpretation of the end-products of xyloglucan hydrolysis is presented....
- 8
- 646
- 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... AGCAAGCACTACGTATCACGACAAACCAACATH1_F GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAATATH1_G ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGCATH1_3633_BHGGATCCTCATTGAGAACAATTTCCTTGAATH1_395_BHGGATCCATCATGTTCTCATCATCATAATATGATH1_209_BHGGATCCGTTAAATATAATGCAGTGACGAAGATAATH1_140_BHGGATCCAAGTCAAACCTTGAGAAAGAACGAmCherry–pSC1_D ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAACATH1_pUG36_D GCACTAGTATGAAAAGAATAAGATCGCTTTATH1_pUG36_R GCCCCGGGATCATTGAGAACAATTTCCATH1_)1000_BH GCGGATCCGTATGACCACATTCTATACTGAATH1_+508 GAGCCAATATCAAATCTGGTGGTAATCCATH1_A ... TTGAACTACGATCCAGAAGCATH1_3633_BHGGATCCTCATTGAGAACAATTTCCTTGAATH1_395_BHGGATCCATCATGTTCTCATCATCATAATATGATH1_209_BHGGATCCGTTAAATATAATGCAGTGACGAAGATAATH1_140_BHGGATCCAAGTCAAACCTTGAGAAAGAACGAmCherry–pSC1_D CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAAmCherry–pSC1_R...
- 15
- 475
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE65a-His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. ... suggesting that RPE65c is likely an enzyme in the zebrafish eye.Phylogenetic tree analysis suggested that the ances-tral forms of zebrafish RPE65c and 13cIMH were gen-erated by gene duplication before ... zebrafishRPE65a (an orthologue of human RPE65) did notcompletely attenuate 11cRAL regeneration in the zebra-fish eye [39]. In that study, evidence was providedshowing that there is another isomerohydrolase...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... tristetraprolin and BRF1 [41–44].However, both 5¢-to3¢ and 3¢-to5¢ pathways can besimultaneously engaged in mRNA decay in an ARE-mediated manner [45], suggesting that the pathwayof mammalian ARE-mediated ... can beflexible. Recently, an excellent database compiling AREcontaining transcripts was established [46] and it hasbeen predicted that approximately 8% of human genescode for transcript that ... ourstudies show that PAI-2 mRNA harbours a spatial andfunctional class I ARE profile that is more analogous to that of highly-regulated cytokines and oncogenes,including granulocyte macrophage-colony-stimulatingfactor...
- 14
- 635
- 0
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt
... mouse and human Meis3, which represent the 3.2isoform, and we show that a similar Meis3 isoform is also present in multiple mouse tissues. Semiquantita-tive RT-PCR suggests that the Meis3.2 ... key regulatory domain within theseproteins that can mediate both positive and negativeinfluences on transcriptional activity. Interestingly,splice variants of mammalian Meis1 and Meis2, andDrosophila ... Meis2-F, 5¢-AGGACATCGCGGTCTTCG-3¢; Meis2-R, 5¢-GAGGTCGATGGGCATTTTC-3¢;Meis3-F, 5¢-GATGATCCAGCCATCCA-3¢; Meis3-R, 5¢-GGCTGGGTAGTCCTCGAAGT-3¢; mMeis3-F, 5¢-GTCCAGGCCATCCAGGTACT-3¢; and mMeis3-R,...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc
... wefocused substantial effort on its characterization. TheDRc DNAzyme with new catalytic activity can arisefrom an existing DNAzyme scaffold, indicating that asingle DNA sequence can catalyze the ... RNA substrate and DNAzyme synthesiswithout any chemical modification, and convenient useof RNase A as a common bioreagent, an attractiveproperty for DNAzymes that have various applications.In ... activities simultaneously coex-ist in DRc DNAzyme, and the DNA cleavage activity can be reversiblyregulated by a conformational transition.AbbreviationsDRc DNAzyme, DNA-cleaving and RNA-cleaving...
- 7
- 601
- 0
Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx
... article describes thepurification and characterization of this peptide, andshows that 8K-BLP is more like IGFs than like insulinin many respects, and that 8K-BLP and bombyxin func-tion in different ... B. mori.Expression analysis reveals that this IGF-like peptide is predominantlyproduced by the fat body, a functional equivalent of the vertebrate liverand adipocytes, and is massively released ... and the good agreement between the predicted andmeasured mass values of 8K-BLP led us to conclude that 8K-BLP is a single-chain peptide. This structuralfeature indicates that this peptide is...
- 12
- 707
- 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... by three,this implies that the translocated ion to ATP ratio is not an integer. It has been suggested that an elasticpower transmission between F1and F0 is importantfor operation of the ... 1. Isolation and subunit composition ofthe c rings from the Na+F1F0ATP synthasefrom A. woodii. Samples of isolated enzyme(lane 1) and isolated c rings (lanes 3, 4 and7) were boiled at ... 10 mm Tris ⁄ HCl (pH 8.0),200 mm NaCl and 3 mm NaN3for 24 h at 25 °C andanother 24 h at 37 ° C. The 2D crystals were stored at 4 °Cuntil further analysis.Atomic force microscopy An atomic...
- 9
- 773
- 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... wasshown that the leukocyte common antigen-relatedtyrosine phosphatase interacts with the ankyrin-repeatregion of DAPK-1 and dephosphorylates DAPK-1 at pY491 ⁄ 492 to stimulate its proapoptotic and ... tissue, the s-DAPK-1 isoform was alsofound to be repressed and undetectable (Fig. 1E).These data indicate that s-DAPK-1 expression canoccur in primary human cancers, and the product ofthis ... Gallagher PJ(2002) A death-associated protein kinase (DAPK)-inter-acting protein, DIP-1, is an E3 ubiquitin ligase that promotes tumor necrosis factor- induced apoptosis andregulates the cellular...
- 11
- 659
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoatai lieu lop 5 khoa hoc bai an toan va tranh lang phi khi su dung dientai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop luctai lieu bao cao thuc tap nau anNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam