Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy Mogridge Department of Laboratory ... has been shown previously that inhibition of the ERK pathway is sufficient to induce apoptosis. It is unclear why the mutant is defec- tive at causing pyropto...

Ngày tải lên: 16/02/2014, 09:20

... intermediate product (Fig. 5) confirms that the substrate is not hydrolyzed to its repeating unit XXXG. Moreover, it can be con- cluded that Cel74A is not able to hydrolyze xyloglucan at unbranched ... general degradation, presumably by con- taminating enzyme activities. Nevertheless, this sub- strate mixture is still very useful for the qualitative analysis of the degradation patt...

Ngày tải lên: 19/02/2014, 05:20

... AGCAAGCAC TACGTATCACGACAAACCAAC ATH1_F GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATH1_G ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC ATH1_3633_BH GGATCCTCATTGAGAACAATTTCCTTGA ATH1_395_BH GGATCCATCATGTTCTCATCATCATAATATG ATH1_209_BH GGATCCGTTAAATATAATGCAGTGACGAAGATA ATH1_140_BH GGATCCAAGTCAAACCTTGAGAAAGAACGA mCherry–pSC1_D ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC...

Ngày tải lên: 18/02/2014, 06:20

... TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE65a-His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. ... suggesting that RPE65c is likely an enzyme in the zebrafish eye. Phylogenetic tree analysis suggested that the ances- tral forms of zebrafish RPE65c and 13cIMH w...

Ngày tải lên: 14/02/2014, 14:20

... tristetraprolin and BRF1 [41–44]. However, both 5¢-to3¢ and 3¢-to5¢ pathways can be simultaneously engaged in mRNA decay in an ARE- mediated manner [45], suggesting that the pathway of mammalian ARE-mediated ... can be flexible. Recently, an excellent database compiling ARE containing transcripts was established [46] and it has been predicted that approximately 8% of human genes code f...

Ngày tải lên: 16/02/2014, 09:20

... mouse and human Meis3, which represent the 3.2 isoform, and we show that a similar Meis3 isoform is also present in multiple mouse tissues. Semiquantita- tive RT-PCR suggests that the Meis3.2 ... key regulatory domain within these proteins that can mediate both positive and negative influences on transcriptional activity. Interestingly, splice variants of mammalian Meis1 and Meis2, an...

Ngày tải lên: 16/02/2014, 15:20

... we focused substantial effort on its characterization. The DRc DNAzyme with new catalytic activity can arise from an existing DNAzyme scaffold, indicating that a single DNA sequence can catalyze the ... RNA substrate and DNAzyme synthesis without any chemical modification, and convenient use of RNase A as a common bioreagent, an attractive property for DNAzymes that have various appl...

Ngày tải lên: 16/02/2014, 15:20

... article describes the purification and characterization of this peptide, and shows that 8K-BLP is more like IGFs than like insulin in many respects, and that 8K-BLP and bombyxin func- tion in different ... B. mori. Expression analysis reveals that this IGF-like peptide is predominantly produced by the fat body, a functional equivalent of the vertebrate liver and adipocytes, and is...

Ngày tải lên: 18/02/2014, 13:20

... by three, this implies that the translocated ion to ATP ratio is not an integer. It has been suggested that an elastic power transmission between F 1 and F 0 is important for operation of the ... 1. Isolation and subunit composition of the c rings from the Na + F 1 F 0 ATP synthase from A. woodii. Samples of isolated enzyme (lane 1) and isolated c rings (lanes 3, 4 and 7) were boi...

Ngày tải lên: 18/02/2014, 17:20

... was shown that the leukocyte common antigen-related tyrosine phosphatase interacts with the ankyrin-repeat region of DAPK-1 and dephosphorylates DAPK-1 at pY491 ⁄ 492 to stimulate its proapoptotic and ... tissue, the s-DAPK-1 isoform was also found to be repressed and undetectable (Fig. 1E). These data indicate that s-DAPK-1 expression can occur in primary human cancers, and the produ...

Ngày tải lên: 18/02/2014, 17:20