Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... compilation ª 2011 FEBS Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein Kentaro Takahama1,*, Katsuhito Kino2,*, Shigeki Arai3, Riki Kurokawa3 and Takanori ... pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... primers: KGG3-2 forwardd(AAA GGT GGC AAA GGT GGA GAC AGA GGTGGC TT) and KGG3-2 reverse d(GAA CAT TCC ACCGGG ACC ACC AC). pGEX–KGG3-4 was generated byPCR using pGEX–KGG2 as a template and the followingprimers:...

... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... mean value was calculated.Bactericidal assay with normal human serumComplement-sufficient normal human serum was prepared and pooled from eight healthy adult donors. A bactericidalassay was ... Barenkamp SJ, Robbins JB, Tsai CM,Lim DJ & Battey J (1998) Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect...

... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing ... kinasecomplex-associated protein AAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine synthetase ACGGAGGTTGACGGGACTTGCTGGCACCACGATTGGDelta-9-desaturase ... GATACAGCAAACGGAAAGTCAACACAGTTCCTCGGGCCAACACystatin B GCCCCCCTCCCACACACATCTTCGGCCGTCTTTCCCTSL GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK...

... region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained after digestionFig. 3.45Ca overlay analysis ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T...

... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- and C-terminal sequences of b-amyrin synthase from ... for soyasapogenol A is not as simple as that for soyasapogenol B, and the presence of additional hydroxylases must beconsidered. Fortunately, the aglycone of the majorsoyasaponins is soyasapogenol ... The Authors Journal compilation ª 2006 FEBS 959 Identification of b-amyrin and sophoradiol 24-hydroxylaseby expressed sequence tag mining and functionalexpression assayMasaaki Shibuya1, Masaki...

... (4481) and JUND (3727).Pathway analysisPathway analysis was conducted using pathwayassist soft-ware (Iobion Informatics LLC, Stratagene, La Jolla, CA,USA) and the Online Predicted Human Interaction ... usingrelative quantitative real-time PCR as for Fig. 2. For each sample,b-actin was evaluated as a reference gene and used for normaliza-tion. For each gene, data are presented as the fold-increase ... IFN-inducible transcriptional activation in the absence of the STAT2 DNA binding domain as determined by Affymetrix DNA microarrayanalysis. Total mRNA samples from U 6A- 2, U 6A- 2VV-II and U 6A cells either...

... sense5¢-UCAUCACACUGAUAACCAACACUGA-AG-3¢;#2578,sense 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢; and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAGUUCUG-AG-3¢. The forward sequence of the scrambledRNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAGAG-3¢. ... materials weredissolved in 20 mm Tris ⁄ HCl (pH 7.5) and used for theactivity assay. The main fraction contained a 75 kDamatriptase as a major component and a few contamin-ating proteins as analyzed ... synovial fluid and interstitial fluid, as well as culture media [24,25]. Several types of proteinases,such as pregnancy-associated plasma proteins [26,27],prostate specific antigen [28] and MMP-3...

... AAAAAGCAGGCTCCGAAGGAGATATAAAAATGAAAACTGATAGATTACTGyef1-attB2R AGAAAGCTGGGTGGATTGCAAAATGAGCCTGACattB1 ACAAGTTTGTACAAAAAAGCAGGCTattB2 ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII ... ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII ... ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII...

... bicincho-ninic acid assay with BSA as standard [30].PNGase F treatmentPNGase F treatment (New England Biolabs, Beverly, MA,USA) was performed according to the manufacturer’sinstructions.Critical active-site ... using an ECL kit. Fordensitometric analysis, data were captured using a FujiLAS-1000 Imaging System CCD camera (aida 2.11 soft-ware for analysis).ACE2 ⁄ ACE activity assaysFluorogenic assays ... may play an important role incardiorenal disease and it has also been implicated as a cellular receptorfor the severe acute respiratory syndrome (SARS) virus. The ACE2 active-site model and...

... lg of total CRS (lane 3),with nuclear proteins and 9 lg of polyclonal anti-eEF 1A (lane 4), withnuclearproteinsand0.9lg of polyclonal anti-eEF 1A (lane 5), withnuclearproteinsand9lg of total ... with an eEF 1A mAb. As an internal normalizer of loading amounts and focusingposition, the nuclear protein, Ran-GTP, was used and identified by a specific mAb. The data reported in Fig. 8A clearly ... biosynthesis and the capture of deacylated tRNA at the exit site and its delivery to synthase[30]. It has been suggested that eEF 1A might serve also as a downstream component of growth-signalling pathways,possibly...