Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... 2010 The Authors Journal compilation ª 2010 FEBS Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl ... & Auling G (1998) Clon- ing and sequencing of the nrdF gene of Corynebacterium ammoniagenes ATCC 6872 encoding the func...

Ngày tải lên: 15/02/2014, 01:20

14 873 0
Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx

Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx

... molecular basis for new therapeutic strate- gies targeting specific pathways to treat human heart disease. Materials and methods Animals Neonatal Wistar rats (1-3 days) were purchased from the Animal ... kDa nucleolin ⁄ C23 fragment accompanied by the appear- ance and an increase in the 80 kDa fragment (Fig. 2). Although both the untransfected cells and the cells transfected...

Ngày tải lên: 16/02/2014, 09:20

11 615 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

... Ca 2+ -dependent manner almost as effectively as intact Akazara scallop troponin. Therefore, Akazara scallop troponin regulates the contraction through the activating mechanisms that involve the region spanning ... of both TnC and Ca 2+ ; lanes b and e, in the presence of TnC and the absence of Ca 2+ ; lanes c and f, in the presence of both TnC and Ca 2+ . Ac...

Ngày tải lên: 20/02/2014, 01:20

12 515 0
Tài liệu Báo cáo khoa học: "Event Matching Using the Transitive Closure of Dependency Relations" pdf

Tài liệu Báo cáo khoa học: "Event Matching Using the Transitive Closure of Dependency Relations" pdf

... four types of features using the event of “Abdul Halim Khaddam resigns as Vice President of Syria” and the sentence The resignation of Khaddam was abrupt” as an example. In particular, the “depth” features ... de- noting the index of the word that is the descendant in d x and d x .a denoting the ancestor. We define the following matching function to match...

Ngày tải lên: 20/02/2014, 09:20

4 392 0
Tài liệu Báo cáo khoa học: Dimer asymmetry and the catalytic cycle of alkaline phosphatase from Escherichia coli doc

Tài liệu Báo cáo khoa học: Dimer asymmetry and the catalytic cycle of alkaline phosphatase from Escherichia coli doc

... change in path C, and enabling a conformational change in path A, thereby increasing the rate of both cycles. In reaction path A, binding of Mg 2+ to subunit 2 induces a conformational change from ... Dimer asymmetry and the catalytic cycle of alkaline phosphatase from Escherichia coli Stjepan Orhanovic ´ and Maja Pavela-Vranc ˇ ic ˇ Department of Chemistry, Facu...

Ngày tải lên: 21/02/2014, 00:20

9 590 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

... a DNA-binding domain, a ligand-binding domain and a transactivation domain. The DNA-bind- ing domain is responsible for DNA binding specificity and dimerization, and the ligand-binding domain is responsible ... eukaryotes indicate that they have crucial and distinct roles in gene activation and other cellular events. Although the discovery of MLLs and characteriza...

Ngày tải lên: 16/02/2014, 14:20

15 607 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

... qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78, AaHR39, AaHR78 (B) and AabFTZ-F 1A, AabFTZ-F1B, AaHNF- 4A, AaHNF-4B, AaHNF-4C (C) are presented ... biological repli- cates were analyzed, and Fig. 2 depicts the profile matching both replicates. An increase in transcript abundance for AaEcRA, AaEcRB, AaE7 5A, AaE75B, AaE75C, Aa...

Ngày tải lên: 18/02/2014, 13:20

22 578 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan ... kit (Stratagene, La Jolla, CA, USA). Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATC GCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGT GCT ATTCTACCAAAAGAATGGCC-...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

... outer reverse ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific ... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAAT...

Ngày tải lên: 19/02/2014, 02:20

11 663 0
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

... 5¢-GGGCACTC AGCCAGGGGACATCCTGCCCAA-3¢ as forward and 5¢-GATACAAGTTTGCACACCTTTGCACTTCTG-3¢ as reverse [58]. The PCR amplification was performed in a total volume of 50 lL reaction mix containing 1 ... concentration and qual- ity, the GAPDH gene was also amplified by using a similar protocol with the housekeeping gene specific primers: 5¢-CCATGGAGAAGGCTGGGG-3¢ as forward and...

Ngày tải lên: 19/02/2014, 16:20

14 683 0
w