Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.Database Structural data for the two RNase A complexes are available in the Protein Data Bank ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

... described in Garget al. [13], whereas the data of WhiB3 and WhiB4 were taken from Alam & Agrawal [14] and Alam et al. [15] respectively.Md. S. Alam et al. Molecular properties of M. tuberculosis ... proteins of Mycobacterium tuberculosisH37RvMd. Suhail Alam, Saurabh K. Garg* and Pushpa AgrawalInstitute of Microbial Technology, CSIR, Chandigarh, IndiaMycobacterium tuberculosis has a remarkable ... line) after the baseline correc-tion. The spectra for WhiB3 and WhiB4 are taken from Alam & Agrawal [14] and Alam et al. [15], respectievely.Md. S. Alam et al. Molecular properties of M....

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate speciﬁcity docx

... Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACTGTTAAAGGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAATGGAGCACTCCATTTTTAGCGCTCGC-3¢ . R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. ... R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAGAAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCGAGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢Sequence veriﬁcationPlasmids of the seven mutants were transformed ... E52Q-fwd:5¢-GCCTGCTGACCCAGCCCGTCGAGAAGTGGCGC-3¢. E52Q-rev:5¢-GCGCCACTTCTCGACGGGCTGGGTCAGCAGGC-3¢. Y70W-fwd:5¢-CTGCTGGAGCTGATGTGGAAAGATCCCAAGAAG-3¢. Y70W-rev :5¢-CTTCTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢. Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢....

Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt

... weadded a BamHI site upstream from the ATG codon, usingthe 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCTGCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGACTCACTATAGGGCGAATTGGG-3¢). Ampliﬁcation wasperformed ... The Authors. Journal compilation ª 2005 FEBS 6023Fish and molluscan metallothioneins A structural and functional comparisonLaura Vergani1, Myriam Grattarola1, Cristina Borghi2, Francesco ... Theabsorbance decrease at 254 nm was reported as a fraction of thestandard absorbance (absorbance at room temperature) in order tocompare the denaturation proﬁle of the Cd–thiolate chromophore of the two...

Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in ﬁbrinolysis and plasmin-induced cell detachment and apoptosis docx

... plasmin anchorage and subsequent proteolyticactivity. These structural and functional transitionsare determinant in the initiation and acceleration of ﬁbrinolysis and cell detachment and may ... Montes R, Paramo JA, Angles-Cano E & Rocha E(1996) Development and clinical application of a newELISA assay to determine plasmin-alpha2-antiplasmincomplexes in plasma. Br J Haematol 92, ... cells; lane 5, Glu-Pg- and mAb A1 0.2-treated cells; lane 6, Glu-Pg- and mAb 34D3-trea-ted cells. Bands in lanes 1 and 2 correspond to forms I and II of plasmin(ogen). High molecular weight bands...

Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

... primer, human and mouse L4, senseYH47 ACCGCCGCCTTCTCATCTGA RT-PCR primer, human L4, antisenseYH48 TTCTCTGGAACAACCTTCTCG RT-PCR primer, mouse L4, antisenseYH9 ATGGCCTCAGTTCCGAAAACCAACAAAATAGA Northern ... interaction in mammalian rRNA production H. Yang et al. Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4Hushan Yang, Dale Henning and Benigno C. ValdezDepartment of ... blot analysis probe, for 18S rRNAYH11 TTCTGACTTAGAGGCGTTCAGTCATAATCCCA Northern blot analysis probe, for 28S rRNAH. Yang et al. Gua–RPL4 interaction in mammalian rRNA productionFEBS Journal...

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... Molecular and functional characterization of adenylate kinase 2gene fromLeishmania donovaniHe´ctor Villa1, Yolanda Pe´rez-Pertejo1, Carlos Garcı´ a- Estrada1, Rosa M. Reguera1, ... Jose´Marı´ a Requena2,Babu L. Tekwani3, Rafael Balan˜ a- Fouce1 and David Ordo´n˜ez11Departamento de Farmacologı´ a y Toxicologı´ a (INTOXCAL), Facultad de Veterinaria, Universidad ... including bacteria,fungi and mammals. There are no reports about character-ization of this enzyme in parasitic protozoa. Leishmaniadonovani is the aetiological agent for visceral leishmaniasis, a devastating...

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of ﬂavonol synthase from Citrus unshiu pptx

... doi:10.1046/j.1432-1033.2002.03108.xSeveral intermolecular dioxygenases, particularly those of microbial or human origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are ... Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), ﬁve gibberellinC20 oxidases (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum, ... same way asdescribed for the wild-type cDNA.Data base retrievalData base searches and sequence alignments were carriedout with theENTREZ and BLASTsoftware (National Library of Medicine and...

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identiﬁcation of a novel subtype of thyrotropin-releasing hormone receptor ppt

... three sets of primers: ﬁrst set, A5 1 (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); ... (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGATCACC-3¢), respectively. The PCR products ... xTRHR1 and xTRHR2 subtypes were ampliﬁed as described above usingpartially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense...

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... level is a key regulator of the rate of mitochondrialrespiration in the heart allowing ATP and creatine phosphate levels tomaintain relatively constant over a large range of cardiac work rateODE ... acetateassimilation are needed as a result of a coupling between the TCA cycle and acetate activation to acetyl-CoAby acetyl-CoA transferaseStoich FBA, opt,MOMA,FVA, SNANG NG Time series of enzymeactivities ... then glycerol, and ﬁnally acetateLogic sim NG NG Single time points of ﬂuxes and mRNA measuredby microarraysAsenjo AJ, RamirezP, Rapaport I,Aracena J, Goles E& Andrews BA(2007) J MicrobiolBiotechnol...

Xem thêm

Từ khóa: báo cáo khoa học tài liệu báo cáo tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP