Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... Functional and structural analyses of N-acylsulfonamide- linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A complexes ar...

Ngày tải lên: 14/02/2014, 22:20

9 627 0
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

... described in Garg et al. [13], whereas the data of WhiB3 and WhiB4 were taken from Alam & Agrawal [14] and Alam et al. [15] respectively. Md. S. Alam et al. Molecular properties of M. tuberculosis ... proteins of Mycobacterium tuberculosis H37Rv Md. Suhail Alam, Saurabh K. Garg* and Pushpa Agrawal Institute of Microbial Technology, CSIR, Chandigarh, India Mycobacterium tuber...

Ngày tải lên: 18/02/2014, 12:20

18 548 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

... Q81N- fwd:5¢-TGGGCCATGCCCTTT AACAGTTATGTCACG CTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACT GTTAAA GGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAA TGGAGC ACTCCATTTTTAGCGCTCGC-3¢ . R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. ... R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCG AGCGCTAAAAATGGA TTTCTCCATTATTTTTAGC-3¢...

Ngày tải lên: 19/02/2014, 02:20

10 504 0
Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt

Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt

... we added a BamHI site upstream from the ATG codon, using the 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCT GCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGA CTCACTATAGGGCGAATTGGG-3¢). Amplification was performed ... The Authors. Journal compilation ª 2005 FEBS 6023 Fish and molluscan metallothioneins A structural and functional comparison Laura Vergani 1 , Myriam Grattarola 1 , Cristin...

Ngày tải lên: 19/02/2014, 07:20

10 414 0
Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx

Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx

... plasmin anchorage and subsequent proteolytic activity. These structural and functional transitions are determinant in the initiation and acceleration of fibrinolysis and cell detachment and may ... Montes R, Paramo JA, Angles-Cano E & Rocha E (1996) Development and clinical application of a new ELISA assay to determine plasmin-alpha2-antiplasmin complexes in plasma. B...

Ngày tải lên: 20/02/2014, 01:20

14 558 0
Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

... primer, human and mouse L4, sense YH47 ACCGCCGCCTTCTCATCTGA RT-PCR primer, human L4, antisense YH48 TTCTCTGGAACAACCTTCTCG RT-PCR primer, mouse L4, antisense YH9 ATGGCCTCAGTTCCGAAAACCAACAAAATAGA Northern ... interaction in mammalian rRNA production H. Yang et al. Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 Hushan Yang, Dale Henning and Benigno C. Valdez...

Ngày tải lên: 20/02/2014, 01:20

15 433 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani He ´ ctor Villa 1 , Yolanda Pe ´ rez-Pertejo 1 , Carlos Garcı ´ a- Estrada 1 , Rosa M. Reguera 1 , ... Jose ´ Marı ´ a Requena 2 , Babu L. Tekwani 3 , Rafael Balan ˜ a- Fouce 1 and David Ordo ´ n ˜ ez 1 1 Departamento de Farmacologı ´ a y Toxicologı ´ a (INTOXCAL), Facultad de Veterin...

Ngày tải lên: 21/02/2014, 00:20

9 487 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

... doi:10.1046/j.1432-1033.2002.03108.x Several intermolecular dioxygenases, particularly those of microbial or human origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are ... Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), five gibberellin C20 oxidases...

Ngày tải lên: 21/02/2014, 03:20

9 864 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... three sets of primers: first set, A5 1 (5¢- GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢- AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); ... (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢),...

Ngày tải lên: 21/02/2014, 03:20

11 507 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... level is a key regulator of the rate of mitochondrial respiration in the heart allowing ATP and creatine phosphate levels to maintain relatively constant over a large range of cardiac work rate ODE ... acetate assimilation are needed as a result of a coupling between the TCA cycle and acetate activation to acetyl-CoA by acetyl-CoA transferase Stoich FBA, opt, MOMA, FVA, SN...

Ngày tải lên: 14/02/2014, 14:20

91 733 0
w