Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc
... FEBS C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism Sruti Dutta, Debi Choudhury, Jiban K. Dattagupta and Sampa Biswas Crystallography ... Sundd M, Jagannadham MV & Dattagupta JK (2004) Structural basis of the unusual stability and substrate specificity of ervatamin-C, a plant cys...
Ngày tải lên: 14/02/2014, 14:20
... phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic site at the interface of the two domains [4,5]. HAPs can initi- ate ... substrate-free AppA the C a atoms are 2.41 A ˚ apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged distance is only 1.87 A ˚ . Distinct c...
Ngày tải lên: 16/02/2014, 09:20
... Bxe _A2 876 (accession number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS dat...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf
... the chaperone activity of a- crystallin. FEBS Lett 369, 321– 325. 22 Rao CM, Raman B, Ramakrishna T, Rajaraman K, Ghosh D, Datta S, Trivedi VD & Sukhaswami MB (1998) Structural perturbation of a- crystallin ... interact with a number of functional groups, including the aromatic side chains of some amino acids, through a stacking mechanism [42]. The interaction of arg...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc
... lyase pathway). Bottom: cleavage to yield AMPA and glyoxylate (the AMPA pathway), referred to as the GOX pathway. (B) Reaction catalyzed by GO on glyphosate, an alternative to the AMPA pathway ... glyphosate cannot be regarded a mere analog of PEP, but it rather appears to mimic an intermediate state of PEP, pre- sumably that of the elusive carbocation. More than 1000 analogs of gly...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt
... Pervandate and catalase were prepared as described previously [25]. Briefly, vanadate stock solution was prepared as a 200 m M solution of sodium orthovanadate (pH 10). Pervanadate was prepared as ... blotting of lysates from pervanadate-treated cells with an antibody against total tau revealed decreased electrophoretic mobility of tau, with the appearance of an 68-kDa tau species...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt
... ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases Juha P. Kallio 1 , Chiara Gasparetti 2 , Martina Andberg 2 , Harry Boer 2 , Anu Koivula 2 , Kristiina Kruus 2 , Juha ... observed for MaL, that may determine the properties of these asco-laccases at high protein concentrations. Database Structural data are available in the Protein Data Bank dat...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt
... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma- tional rearrangement that exposes the NLS in an extended conformation. Database Structural data are available in ... reflection data file was then passed through a suite of programs in the ccp4 crystallography package [36]. Scaling of intensities and inspection of data quality were performed in scala. I...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTA...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf
... structure and catalysis. Biochemistry 48, 3417–3424. 31 Nakamura T, Matsumura H, Inoue T, Kai Y, Uegaki K, Hagihara Y, Ataka M & Ishikawa K (2005) Crystallization and preliminary X-ray diffraction analysis ... Nakamura T, Yamamoto T, Abe M, Matsumura H, Hagihara Y, Goto T, Yamaguchi T & Inoue T. (2008) Oxidation of archaeal peroxiredoxin involves a hyperva- lent sulfur intermediat...
Ngày tải lên: 14/02/2014, 22:20