‎4 6 interior view of an intestinal bulb at 7 dpf this image is an expanded focus of 32 8 µm of z depth 320 stacks with a z stack size of 0 1 µm the intestinal folding has been started in the ventral side of the intestinal to shape the int

The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation

The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation

Ngày tải lên : 10/09/2015, 09:25
... Kedah, Malaysia, reported an average annual incidence rate of 16 . 35 per 10 0 ,00 0 population between 200 5 and 20 08 14 (Table 1) , as compared to the Pahang state, Malaysia, with an average annualincidence ... Australia9 Thailand 11 Singapore12 Pahang, Alor Setar, Malaysia13 Malaysia14 No of cases 252 22 17 69 3 13 5 14 5 Average annual incidence* 19 .6 12 .7 1 .7 6. 1 16 . 4 19 42 .6 16 . 2 54 34 Average mortality rate ... CATATGCTGGCCGGAATATATC 55 Hcp1R CTCGAGTCAGCCATTCGTCCAGTT 55 Hcp1UpF CCATGATTACGAATTCGTACGTCGTCGACATGGAC A 60 Hcp1UpR TACCCGGGGATCCTCGATGTGGATTTTCCCGTCAT 60 Hcp1DnF GAG GAT CCC CGG GTA TCA CGT TGA CGA AGG AAA...
  • 155
  • 1.1K
  • 0
Báo cáo khoa học: "The interaction between different types of activated RAW 264.7 cells and macrophage inflammatory protein-1 alpha" potx

Báo cáo khoa học: "The interaction between different types of activated RAW 264.7 cells and macrophage inflammatory protein-1 alpha" potx

Ngày tải lên : 09/08/2014, 09:20
... 79 :15 9- 1 67 doi: 10 . 11 86 / 17 4 8 - 71 7X -6- 86 Cite this article as: He et al.: The interaction between different types of activated RAW 264 .7 cells and macrophage inflammatory protein -1 alpha Radiation ... writing and study coordinator YZ (Yong Zhou) and GH contributed to statistical analysis LX, WO and FZ contributed significantly to the acquisition of data and optimization of treatment plans YZ ... values The ΔΔCT values were compared with the control by raising two to the ΔΔCT power Statistical analysis Statistical analyses of data were conducted using oneway analysis of variance (ANOVA) Statistical...
  • 7
  • 380
  • 0
Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf

Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf

Ngày tải lên : 23/03/2014, 10:20
... was 57 .6 pgÆmL )1, QA 50 was 79 .7 pgÆmL )1 and QA 10 0 was 1 17 . 9 pgÆmL )1; at 18 h, QA15 was 72 .9 pgÆmL )1, QA 50 was 92 pgÆmL )1 and QA 10 0 was 1 16 . 8 pgÆmL )1 Murine macrophages were also challenged with ... that from cells challenged with untreated quartz (analysis of variance, P < 0. 0 01 ) The relevant values were: at h, QA15 was 2 56. 5 pgÆmL )1, QA 50 was 502 .2 pgÆmL )1 and QA 10 0 was 8 36. 3 pgÆmL )1; at ... incubated with both AA-treated (striped bars) and untreated (black bars) quartz at increasing particle concentration (analysis of variance, P < 0. 05) AA-treated quartz suspensions at 15 , 50 and 10 0 lgÆmL)1...
  • 14
  • 253
  • 0
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc

Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc

Ngày tải lên : 09/08/2014, 06:23
... 19 93, 1 50: 4 966 -4 977 Katz JB, Limpanasithikul W, Diamond B: Mutational analysis of an autoantibody: differential binding and pathogenicity J Exp Med 19 94, 1 80 :925- 932 Li Z, Schettino EW, Padlan ... cDNA in mammalian cells J Autoimmun 19 98, 11 :66 1 -66 9 Haley J, Mason LJ, Nagl S, Giles I, Latchman DS, Isenberg DA, Rahman A: Somatic mutations to arginine residues affect the binding of human ... ligated into pLN 10 as HindIII/BamHI fragments, distal to an immunoglobulin leader sequence and separated by an intron from a Cλ sequence that lies distal to the insert In both pLN 10 and pG1D1, the...
  • 13
  • 472
  • 0
Báo cáo y học: "A randomized, double-blind study of AMG 108 (a fully human monoclonal antibody to IL 1R1) in patients with osteoarthritis of the knee" pdf

Báo cáo y học: "A randomized, double-blind study of AMG 108 (a fully human monoclonal antibody to IL 1R1) in patients with osteoarthritis of the knee" pdf

Ngày tải lên : 12/08/2014, 17:22
... 41. 4 (11 .1) 0. 51 (0. 50 8. 0) 0. 51 (0. 50 8. 1) 1 68 ( 48 3 36) 48 ( 48 16 9 ) 2 70 0 (1 3 60 ) 1 200 0 (22 30) 86 1 0 ( 3 01 0) 449 ( 213 ) 22.5 (32. 3) Cmax (nM; mean [SD]) 300 mg SC 14 .9 (15 .2) Day (first dose): 300 ... 54 ( 68 ) 54 ( 68 ) White 15 (94) 12 ( 10 0 ) 12 ( 10 0 ) 12 ( 10 0 ) 12 ( 10 0 ) 48 ( 10 0 ) 66 (83 ) 67 (84 ) Black (6) 0 0 (3) (9) - - - - - - 12 (15 ) (8) Mean weight (kg) 83 .8 79 .9 90 .7 85 .5 82 .4 84 .6 87 .6 88 .2 ... interfere in the assay Statistical analysis Patient data were analyzed according to randomized treatment arm regardless of actual treatment received during the study The safety dataset included all patients...
  • 30
  • 277
  • 0
Báo cáo y học: "Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages" pdf

Báo cáo y học: "Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages" pdf

Ngày tải lên : 14/08/2014, 16:21
... proteins at 1, 3, 10 and 30 minutes after stimulation (AfCS protocols #PP 000 00 17 7 and #PP 000 00 18 1 [63 ]), competitive enzymelinked immunosorbant assays to measure cAMP concentrations at 20, 40, 90, ... factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases N Engl J Med 19 97, 3 36: 1 06 6 -1 07 1 Ozato K, Tsujimura H, Tamura T: Toll-like receptor signaling and regulation of cytokine ... 300 and 1, 200 seconds after stimulation (AfCS protocol #PP 000 00 17 5 [63 ]), and a multiplex suspension array system (Bio-Plex, Bio-Rad, # 17 1 -F 11 18 1 ) to measure concentrations of cytokines in the...
  • 14
  • 182
  • 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

Ngày tải lên : 08/03/2014, 09:20
... lactoferrin with a ˚ lanthanide ion (Sm3+) at 3.4 A resolution Acta Crystallogr D55, 17 9 9– 1 80 4 36 Kitamura, T., Gatmaitan, Z & Arias, I.M (19 90) Serial quantitative image analysis and confocal ... that e1 and e (13 300 ± 500 M )1 cm )1) were approximately the same and were only half the value of e2 The slope of the curve of rate constant k1 vs [Yb3+]/protein (1. 2 68 · 10 5 s )1) was again almost ... Chem Rev 1 90 19 2, 2 97 3 08 Lazarescu, G.R & Battista, J.J (19 97) Analysis of the radiobiology of ytterbium- 16 9 and iodine -12 5 permanent brachytherapy implants Phys Med Biol 42, 17 2 7– 17 36 Kampf, G.,...
  • 9
  • 385
  • 0
báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf

báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf

Ngày tải lên : 18/06/2014, 15:20
... Ca2+ free buffer containing IgG (panel A) , the CD66ae mAb and CD66b mAb (panel B), the CD66ae mAb and CD66c mAb (panel C), the CD66ae mAb and CD66de mAb (panel D), the CD66b mAb and CD66c mAb ... Translational Medicine 20 08 , 6: 78 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 CHO cell surface: homophilic and heterophilic adhesion Biochem Biophys Res Commun 1 989 , 16 4 :39-45 Oikawa ... demonstrated [ 10 0 ] CEACAM1 also appears to play a critical role in tumor lymphangiogenesis [15 ], and can regulate cell migration via interaction with filamin A [ 17 ] CEACAM1 associates with the beta...
  • 12
  • 599
  • 0
báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf

báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf

Ngày tải lên : 19/06/2014, 22:20
... Transplantation 200 9, 87 : 17 7 8- 17 86 39 El Annan J, Goyal S, Zhang Q, Freeman GJ, Sharpe AH, Dana R: Regulation of T-cell chemotaxis by programmed death-ligand (PD-L1) in dry eyeassociated corneal inflammation ... 200 3, 1 70 :12 57- 1 266 38 Cheng X, Dai H, Wan N, Moore Y, Vankayalapati R, Dai Z: Interaction of programmed death -1 and programmed death -1 ligand -1 contributes to testicular immune privilege Transplantation ... channel in effector memory T cells as new target for MS J Clin Invest 200 3, 11 1: 1 70 3- 17 1 3 doi: 10 . 11 86 / 17 4 2- 209 4 -8- 15 5 Cite this article as: Pittet et al.: Human brain endothelial cells endeavor...
  • 12
  • 294
  • 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot

Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot

Ngày tải lên : 10/08/2014, 05:20
... Lancet 200 4, 364 : 16 3 - 17 1 Page of (page number not for citation purposes) AIDS Research and Therapy 20 08 , 5 :1 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Martin CH, Kaufman DS: Synergistic ... mix is expressed as 1: 125, 1: 2 50, 1: 500 , 1: 10 0 0, 1: 200 0 and 1: 400 0 Highest stimulation was seen with the lower DC to T cell ratio (1: 125) and the levels of stimulation decreased at higher ratios ... DCs also play an important role in the natural history of HIV infection At the early phase of HIV -1 transmission, DCs capture HIV -1 at mucosal surfaces and transmit the virus to T-cells in the...
  • 9
  • 261
  • 0
Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn

Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn

Ngày tải lên : 29/04/2013, 16:30
... xupap nguội Nạp Xả II 7. 08. 5 mm 8. 0 – 10 . 0 mm 11 .0 – 13 .0 mm 11 .0 – 13 .0 mm 50 – 70 kG 45 – 55 kG 35 – 45 kG 25 – 35 kG – 1 20 BTDC 65 0 ± 50 vg/phút 70 0 ± 50 vg/phút 15 .0 kG/cm2 10 . 0 kG/cm2 0. 15 ... theo quy đònh sau: Loại ôtô khách tải, Moóc, Sơmi rơmoóc Trạng thái kỹ thuật Chu kỳ bảo dưỡng Quãng đường Thời gian (km) (tháng) 1. 500 10 . 000 5 .00 0 1 .00 0 8. 00 0 4 .00 0 1 .00 0 8. 00 0 4 .00 0 ... dưỡng đònh kỳ FIAT SIENA 1. 3 ( có số phiếu bảo dưỡng tham khảo TOYOTA phần phụ lục) Các mục bảo trì Số Km ( × 10 0 0km) 1, 5 20 30 40 50 60 70 80 90 10 0 + + + + + + + + + Kiểm tra hoạt động xe +...
  • 118
  • 4.3K
  • 56
8 cách đơn giản tăng tốc windows 7

8 cách đơn giản tăng tốc windows 7

Ngày tải lên : 13/08/2013, 12:04
... data hộp thoại Edit String nhấn OK): AutoEndTasks =1 HungAppTimeout= 500 0 MenuShowDelay =00 000 000 (8 số 0, mặc định 400 ) WaitToKillAppTimeout= 400 0 (mặc định 200 00) WaitToKillServiceTimeout= 400 0 (key ... Binary Value (hay DWORD Value) menu New Sau đó, thay tên key “New Value #1 tên ● CacheSize: Tạo với giá trị Binary Value, thay tên “New Value #1 CacheSize, chọn Modify để nạp giá trị ff ff 00 00 ... phải, kích đôi vào kho a WaitToKillServiceTimeout để thay đổi giá trị cu a nó Giá trị mặc định cu a kho a này là 1 200 0 (12 giây, thời gian tối a để tắt các dịch vụ trước...
  • 19
  • 440
  • 0
cac nguyen to thuoc nhom 7

cac nguyen to thuoc nhom 7

Ngày tải lên : 11/09/2013, 01:10
... 565 4 31 364 2 97 Độ dài lk H – X (Å) 0, 92 1, 27 1, 41 1 , 60 Độ phân ly α( 200 C ;0, 1N;%) 9 ,0 92 ,6 93,5 95 ,0 Độ phân cực µ (D) Độ tan (00 C; lit khí/lit H2O) 1, 91 1 ,03 0 ,79 04 2 Vô hạn 500 60 0 425 ch a ... thứ tự Cl 17 35 53 85 2s22p5 3s23p5 4s24p5 5s25p5 6s26p5 Bán kính ngtử (Å) 0 ,64 0, 99 1, 14 1, 33 1, 40 N.lượng ion h a I1 17 , 42 13 , 01 11 ,84 10 , 45 9, 50 Ái lực electron (eV) 3, 58 3 , 81 3, 56 3,29 - Độ ... C A MANGAN Hợp chất Mn +7 Kali pemanaganat (KMnO4): tinh thể màu tím đen, dung dịch màu tím đỏ, độ tan biến đổi theo nhiệt độ Ngoài ra, thể tan amoniac lỏng, pyri in, rượu axeton  Trên 200 0C,...
  • 45
  • 754
  • 2
Essential guide to writing part 7

Essential guide to writing part 7

Ngày tải lên : 20/10/2013, 03:15
... www.tailieuduhoc.org 98 THE EXPOSITORY PARAGRAPH establish a master plan at the beginning of the paragraph and to introduce each new idea by a word or phrase that marks its place in the plan The ... coherence All the ideas in a paragraph can relate to the topic yet be poorly arranged Arrangement often inheres in the subject itself A paragraph about baking a cake or preparing to water-ski is committed ... plan and explicitly fit each unit into that plan It is not a method confined to single paragraphs You can use it to organize a portion of a long paragraph (which is what Baldwin does), or expand...
  • 15
  • 371
  • 0
British English A to Z - past 7

British English A to Z - past 7

Ngày tải lên : 23/10/2013, 13:20
... train leaves the metals in Britain it has been derailed rails meteorological office weather bureau And the much reviled official whom the Americans call the weatherman is the clerk of the weather ... fabrics, with the emphasis on silk merchant, n wholesaler The usual implication is that he deals principally in international trade merchant bank approx investment bank Specializing in the acceptance ... potatoes in Britain A pub used to present sausages and mash in the public bar at three shillings and sausages and creamed potatoes in the saloon bar at four shillings, sixpence Same dish masses...
  • 29
  • 443
  • 0
Đề thi HKI Toán 7-Năm 2010.2011             I m«n to¸n - líp 7

Đề thi HKI Toán 7-Năm 2010.2011 I m«n to¸n - líp 7

Ngày tải lên : 27/10/2013, 10:11
... hình viết giải thiết, kết luận đúng: 0. 5đ a) Chứng minh đợc tam giác ABC = tam giác ADE 0 .75 đ b) Chứng minh đợc DE//BC c) Chứng minh đợc AF=AC CFEF 0 .75 đ 0. 5đ ... kỳ I môn to n - lớp Thời gian làm bài: 90 phút Câu 1: Mỗi câu trả lời đợc 0. 25đ câu đáp án Đ S đ s Câu 2: Mỗi ý đợc 0. 25đ câu a b c d đáp án a c d b Tự luận: THPT: Mỗi câu 0.a 20 b - 36 c Tìm ... b - 36 c Tìm x: Mỗi câu 0.a x= 28 b x=9 c x= 16 x= Gọi ẩn viết đợc tỷ lệ thức: 1 - áp dụng tính chất dãy tỉ số có kết đúng: 1 + Lớp 7A: 35cây + Lớp 7B: 25 + Lớp 7C: 15 cây Vẽ hình viết giải...
  • 2
  • 447
  • 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Ngày tải lên : 23/12/2013, 00:15
... deliver a consistent set of messages The aim is to achieve seamless communication with the audience • Internal Communications: information dissemination and flow between an organisation and its ... organisation to invited media The format is usually a presentation of information by the organisation followed by a question and answer session • Pitch: when PR consultancies are invited by a ... journalists and sending out relevant articles to the respective publications, responding to media enquiries, and providing appropriate information on behalf of an organisation • Messages: agreed...
  • 2
  • 490
  • 0
Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt

Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt

Ngày tải lên : 26/01/2014, 04:20
... link sau vào Windows Explorer mục Search menu Start %APPDATA%\Microsoft\Windows\SendTo Nếu bạn có dropbox Favorites, phải chuột vào folder chuyển tới folder Send To Khi bạn dán folder này, bạn di ... hệ điều hành Windows XP, vào Control Panel > Folder Options > Show hidden files and folders Chuyển tới C:\Documents and Settings\[User Name]\SendTo (User Name tên máy tính bạn) tạo shortcut cho ... bạn lưu chia sẻ liệu Nếu bạn muốn dễ dàng truy cập ứng dụng này, bạn thêm vào menu Send To menu context Thêm Dropbox vào mục Send To Windows Vista Đầu tiên, copy đường link sau vào Windows Explorer...
  • 8
  • 385
  • 0
Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx

Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx

Ngày tải lên : 16/02/2014, 11:20
... Sector 17 B Chandigarh - 1 60 0 17 Tel No 0 17 2 - 2 70 3 07 7 , 2 70 74 30 Fax No 0 17 2 – 2 70 4 17 4 , 272 5335 Rayala Tower, 3rd Floor, 1 58- Annasalai-CHENNAI 600 002 Tel -04 4 -66 78 572 2-23, Fax -04 4 -66 78 754 Circle Office, ... Rajendra Bhawan, Rajendra Place, New Delhi -1 10 0 08 Tel No 01 1 - 25 86 4 2 87 Fax No 01 1- 2 573 10 26 Nilgiri Mansion, Bhangagarh, GS Road, Guwahati 78 10 0 5 Tel No 0 3 61 - 2 463 81 2 Fax No 0 3 61 2529229 6- 1 -73 , ... 02 2-2 21 86 4 05 ,22 16 1 399 Fax -02 2-2 215 21 90, 22 16 1 399 R Block Chanakya Place, Patna - 80 0 0 01 Tel.No 06 1 2 - 25 06 1 57 Fax No 06 1 2 – 2224 1 80 Candidates are advised to regularly visit the Bank’s website for intimations...
  • 17
  • 347
  • 0

Xem thêm