you can use a two dimensional array

... Pearson Education Macromedia is a registered trademark, and Macromedia Flash and Flash are trademarks of Macromedia, Inc Throughout this book trademarked names are used Rather than put a trademark symbol ... promote theatrical releases with Flash animations; and online gaming and educational sites provide rich user experiences with Flash interactivity As a vector-based animation and authoring application, ... is a technique for interpolating amorphous changes that can t be accomplished with instance transformations such as rotation, scale, and skew Fill, outline, gradient, and alpha are all shape attributes...

Ngày tải lên: 03/06/2014, 02:04

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... Monod, Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried ... simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG used...

Ngày tải lên: 21/02/2014, 01:21

... from Stratagene The sequence of the oligonucleotides for the mutations at the underlined positions were: 5¢-ACATGGC AACAGGCGGAATCAGGTAAA-3¢ (W3 4A) and 5¢-AT ATTCTAGAAAGCTAACCAGAATCAA-3¢ (Y7 4A) The ... of truncated MspI (deletion of 34 N-terminal amino acids; del34aa) was made using the following set of primers: 5¢-CATATGgaatcaggtaaaaca-3¢ and 5¢-tgttttacctgattccCATATG-3¢ (forward and reverse ... both are human parasites Nocardia aerocolonigenes (the host of NaeI) and Moraxella (host of M.MspI) are also capable of being human parasites Two prototype bacterial m5C-MTases, M.HhaI [32] and...

Ngày tải lên: 24/03/2014, 00:21

... stoichiometric amounts were calculated based on the amino acid analysis performed during the synthesis of b1)34 and calibrated with the FO sample assuming a stoichiometry of ab2c10 Dialysis was carried ... subunits a, b and c [18] Whereas significant initial rates of H+ translocation could already be observed with a stoichiometric ratio of intact subunit b and ac subcomplex, a 6.6-fold molar excess ... revealed that an approximately 6-fold molar excess of b1)34 was necessary to obtain saturated H+ translocation activities, whereas the use of higher molar ratios had no further stimulating effect...

Ngày tải lên: 23/03/2014, 13:20

... know that the most typical examples of basic Hopf algebras of finite representation type are Taft algebras and the dual of A( n, d, μ, q), which as an associative algebra is generated by two elements ... generally tame Hopf algebras, we need more examples of tame Hopf algebras The Andruskiewitsch-Schneider algebra is a kind of generalization of generalized Taft algebra and of course Taft algebra Therefore, ... Therefore, it is natural to ask the following question: whether is the quantum double of dual AndruskiewitschSchneider algebra a tame algebra? In this paper, we give an a rmative answer As a consequence,...

Ngày tải lên: 06/08/2014, 05:20

... 1970; Ganesalingam, 1974) At the anterior tip of each ovariole, a bacteriome containing intracellular bacteria is formed (Mansour, 1930; Nardon, 1971) This apical bacteriome disappears in the absence ... Temperature-sensitive gaster IV A mutation affecting Nat Acad Sci USA 67, 738-745 eye facet mutations in arrangement in a Drosophila melanopolarized manner Proc Ganesalingam VK (1974) Morphological ... type at 29°C and mutant type at 21°C, Foster and Suzuki, 1970); and in a homeotic mutation affecting imaginal discs, giving normal arista segment of the antennal complex at 29°C and a tarsus at...

Ngày tải lên: 09/08/2014, 18:21

... patients were bilaterally affected Fifty four patients had CTS hands on the unilateral side and 54 contra-lateral hands were asymptomatic The diagnosis of CTS in all patients was reconfirmed at ... patients for anatomical and pathological reasons [13] Kwon et al revealed that C6, C7 radiculopathy had no significant influence on sensory responses while C8 radiculopathy had no significant influence ... values for each group are presented as means + standard deviation (SD) using statistical software (Statview 4.5J, SAS, Cary, NC) The significance of differences between the values was analyzed using...

Ngày tải lên: 10/08/2014, 10:20

... times and A similar comparison between times and showed a small nonsignificant increase in PaO2 and SaO2 in groups A1 and B1, and a significant increase (P < 0.05) in PaO2 and SaO2 in group C After ... nonsignificant change in PaO2 and SaO2 at times 3, and at all times In patients in groups A2 and B2, SaO2 was never below 93% during the two manoeuvres [5] PaCO2 remained stable, without significant ... considered statistically significant In all patients, LVEF was assessed by cardiac angiography Results The arterial blood samples to determine oxygen (PaO2) and carbon dioxide (PaCO2) tension and oxygen...

Ngày tải lên: 12/08/2014, 18:20

... data were collected and analyzed with commercially available data management and statistical software All data are shown as means ± SD Data were analyzed with analysis of variance for repeated ... averaged on a minute-to-minute basis and saved to a personal computer for later analysis Mixed expired CO2 concentration (PeCO2) was also measured and used along with the partial pressure of arterial ... triplicate At the 3-h time point, arterial and pulmonary artery blood was drawn for measurements of blood gases, pH, and oxygen saturation Samples were drawn, iced, and analyzed within by using standard...

Ngày tải lên: 12/08/2014, 18:20

... the area without permission A You can enter the area if you ask for permission B You can t enter the area under any circumstances C You can t enter the area without allowance D You are not allowed ... his mistakes at C his mistakes laughing at D his mistakes at laughing Question 47: I can t go with you today; I have…………… things to A a great deal B many a great C great many D a great many Question ... movement of American Indians across North America C Ceremonies and rituals of American Indians D The way of life of American Indian tribes in early North America Question 72 According to the passage,...

Ngày tải lên: 08/10/2014, 16:46

... office as I can get there in five minutes A comfortable B near C available D convenient Question 30 : The boy has chosen to MBA programme in Australia A the B Þ C an D a Mark the letter A B ... A Because of the bad weather, our excursion to London was put off later B Our plans for an excursion to London have fallen through because the weather was so bad C The bad weather was the reason ... that can hold ideas and images for years and years Information can be added to your long-term memory when you actively try to put it there through memorization or when an idea or image enters your...

Ngày tải lên: 08/10/2014, 16:46

... 1:296-305 Braithwaite RS, DeVita MA, Mahidhara R, Simmons RL, Stuart S, Foraida M: Use of medical emergency team (MET) responses to detect medical errors Qual Saf Health Care 2004, 13:255259 Kaplan LJ, ... Localio AR, Weaver SL, Landis JR, Lawthers AG, Brenhan TA, Hebert L, Sharp TJ: Identifying adverse events caused by medical care: degree of physician agreement in a retrospective chart review Ann ... Critical Care Vol 13 No Amaral and Shojania meeting to review each case in order to identify clinical deteriorations that had resulted primarily from problems in antecedent care Two previous...

Ngày tải lên: 25/10/2012, 10:06

... island, deep temporal fascia, and also segmental parietal bone can be raised with this flap The TPFF and its variants can be used as free or pedicled, one or two- stage (prefabricated and prelaminated) ... primary conchal cartilage grafts, a free temporoparietal fascial flap, and a full-thickness supraclavicular skin graft.19 The temporoparietal fascial flap has been commonly used for coverage ... 2009; 123(2): 556-61 Navarro-Ceballos R, Bastarrachea RA Clinical applications of temporoparietal hair-bearing flaps for male pattern baldness and mustache formation Aesthetic Plast Surg 1991; 15(4):343-8...

Ngày tải lên: 25/10/2012, 11:00

... under a microscope At least 100 cells were counted for each treatment Statistical analysis was performed using GraphPad InStat (GraphPad Software, San Diego, California, USA) Anticancer activity ... folds at stage III in prostate cancer (Fig 1) Because cancer undergoes metastasis and spreads to other organs at late stages, we speculated that RIZ1 might play an important role in tumor metastasis, ... in normal and cancer patients for each cancer type was performed with GraphPad Prism 4.0 (GraphPad Software, San Diego, California, USA) 162 Cell culture of HuH7 cell line Human hepatoma HuH7...

Ngày tải lên: 25/10/2012, 11:15

... imaging software Statistical Analysis Data are presented as mean ± SD Data of multiple groups were analyzed by one-way analysis of variance Means between two groups were compared with a two- tailed ... dehydrogenase (GAPDH): forward: 5’-GCGCCTGGTC ACCAGGGCTGCTT-3’, reverse: 5’-TGCCGAAGTG GTCGTGGATGACCT-3’; b) Cx40-1: forward: 5’-ATGCACACTGTGCGCATGCAGGA-3’, reverse: 5’-CAGGTGGTAGAGTTCAGCCAG-3’; ... Hematoxylin/eosin staining of the iliac arteries in the normal group (panel A) , high fat diet group (panel B), and high fat diet plus losartan group (panel C) In panel A, the elastic lamina was...

Ngày tải lên: 26/10/2012, 09:39

... infection among African Americans (86%), compared to Caucasians (68%) (p=0.02) In addition, African American had a lower rate of sustained viral response (SVR) to interferon and ribavirin treatment ... among different racial and ethnic groups with HCV infection For unclear reasons, African Americans appear to have a higher rate of chronic HCV infection than Caucasians and Hispanic whites In prospective ... National Health and Nutrition Examination Survey (NHANES), a national survey of a representative sample of non-institutionalized civilian Americans conducted between 1988 and 1994 In the NHANES...

Ngày tải lên: 02/11/2012, 09:56

... selective abortion, i.e termination of pregnancy after the prenatal diagnosis of severe fetal defects was also named as secondary prevention Recently the WHO and other international bodies have excluded ... to achieve a complete recovery in 33.5% of cases with congenital abnormalities Thus, there are two main conclusions: at present the major part of congenital abnormalities (85.3%) are preventable; ... of primary prevention Tsitologija i Genetika 2002; 36: 56-71 Figure Figure Classification of Congenital Anomalies Congenital Anomalies (Birth Defects) Congenital abnormality (CA) (e.g neural-tube...

Ngày tải lên: 02/11/2012, 11:12

... promoters and enhancers (etc) can be included in MACs Preliminary research indicates that MACs can be used, via pronuclear microinjection, to create transgenic animals in which the MACs are maintained ... does appear to be somewhat better than that of pronuclear microinjection The available experimental data on standard human ICSI (i.e not involving genetic modification) indicate that: (a) the majority ... Hirabayashi M, Takahashi R, Ito K, et al A comparative study on the integration of exogenous DNA into mouse, rat, rabbit, and pig genomes Exp Anim 2001; 50(2):125-131 Bishop JO Transgenic Mammals...

Ngày tải lên: 03/11/2012, 10:01

... (0.01-0.47) * Anencephaly 2, Anencephaly +spina bifida (lumbal, thoracolumbal) 2, Spina bifida 2, thoracolumbal 1, lumbosacral ** Anencephaly ***Anencephaly 1, Spina bifida 8, thoracolumbal 1, lumbal 4, ... and other candidate CAs [14] On the other hand the large population-based dataset of the Hungarian Case-Control Surveillance of Congenital Abnormalities (HCCSCA) [17] can provide a chance for ... acid As far as I know the Hungarian data sets are unique to answer these questions On the one hand now the results of the two Hungarian intervention trials are available and their pooled data...

Ngày tải lên: 03/11/2012, 10:05

... Hepatitis B Foundation of America; an Appropriation from the Commonwealth of Pennsylvania USA, Nucleonic Inc (PA USA) Drs Satishchandran C and Cathy Pachuk (Nucleonics Inc, PA, USA), Baohua Gao ... hepatitis B virus envelope are virus neutralizing Vaccine 1986 4(1): 35-7 34 Machida A, Kishimoto S, Ohnuma H, Miyamoto H, Baba K, Oda K, Nakamura T, Miyakawa Y, Mayumi M A hepatitis B surface antigen ... C, Ruvoletto MG, De Falco S, Marino M, Valente M, Nitti D, Gatta A, Fassina G Overexpression of squamous cell carcinoma antigen variants in hepatocellular carcinoma Br J Cancer 2004 90 (4): 833-837...

Ngày tải lên: 03/11/2012, 10:09