... Sample Code Example code for the 8051 Microcontroller basic .c - A very basic example of writing C code for the 8051 int .c - A rewrite of the serial example to use interrupts in C serial .c - Example ... reached */ while (codeptr
Ngày tải lên: 20/01/2014, 02:20
... nearly all classic C+ + code with the /clr option The C+ + language as extended by the C+ +/CLI language extensions is (for all practical purposes) a superset of the classic C+ +, so any C+ + application ... Most of the examples in this book will compile in safe mode, except for the code in Chapter 12, which deals specifically with unverifiable code, and code that uses specific constructs such as unsafe ... seen, code compiled with /clr rather than /clr:pure or /clr:safe may contain platform-specific code Also, even in pure mode, you can invoke platform-specific functions If you want to produce an...
Ngày tải lên: 05/10/2013, 07:20
African Regional Implementation Review for the 14th Session of the Commission on Sustainable Development (CSD-14) pot
... Much of the success is attributed to the application of Cleaner Production (CP) concept in manufacturing processes in SMEs in various countries where National Cleaner Production Centres (NCPCs) ... APINA ARSCP ARI ALRI CFCs CP CSD ESALIA EST GAW GCOS GEF IGBP IPCC JPoI LPG NACA NEPAD NCPC START SADC SAFARI SME SAPIA UNIDO UNCED UNFCCC WHO WSSD Atmospheric Pollution Prevention Act Air Pollution ... (NOx) are the primary causes of acid rain It occurs when these gases react in the atmosphere with water, oxygen and other chemicals to form various acidic compounds Sunlight increases the rate...
Ngày tải lên: 06/03/2014, 19:20
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx
... The primer pairs for site-directed mutagenesis were as follows: 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E190A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ ... 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E190A, 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E199A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC ... 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E204A Mutated codons are shown in italic type Dimethylsulfoxide was added to a final concentration of 5% (v ⁄ v) to reactions in which strong secondary...
Ngày tải lên: 07/03/2014, 04:20
The CRS Project Package Project Management and Implementation Guidance for CRS Project and Program Managers pot
... Checklist 2.3 Checklist 2.4 Checklist 2.5 Checklist 2.6 Checklist 2.7 Checklist 2.8 Checklist 2.9 Checklist 2.10 Checklist 2.11 Checklist 2.12 Checklist 2.13 Checklist 2.14 Are You a Critical Thinker? ... Checklist 6.2 Checklist 6.3 Checklist 6.4 Checklist 6.5 Checklist 6.6 Checklist 6.7 Checklist 6.8 Checklist 6.9 Checklist 6.10 Checklist 6.11 Project Managers’ Responsibilities During Implementation ... Office (CRS) Code of Federal Regulations Caritas Internationalis Catholic Relief Services International Center for Tropical Agriculture Consortium for Southern Africa Food Security Emergency Consolidated...
Ngày tải lên: 16/03/2014, 03:20
Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafficking pdf
... the efficacy of drug response To further characterize this, dose–response curves were constructed for two of these and it was found that the Ki was not significantly affected once the differences ... the original mask by 0.4 lm in each direction), which excludes the membrane and membrane associated area but includes the intracellular contents The total fluoresence in each situation is calculated ... causing cystic fibrosis forms a functional chloride conductance in Xenopus laevis oocytes but not in mammalian cells The explanation is that the trafficking is temperature dependent: it occurs at...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo hóa học: " Analysis of in vitro replicated human hepatitis C virus (HCV) for the determination of genotypes and quasispecies" docx
... is the base adjacent to the string of C' s where sometimes an extra C was found, and where the deletion was located in samples from patient 313 The sequences in that region are ACCCCCCCUCCCG, ... B-cells HCV grown in B-cells and non-committed lymphoid cells showed consistent sequence changes, while HCV grown in T-cells had inconsistent changes, therefore lacked sequence commonality T-cells ... retransmissions of HCV JGP performed the clinical work, recruitment of patients, and procurement of specimens DR, MOA, RSB, DB, and NC performed the molecular work Acknowledgements The California Institute...
Ngày tải lên: 20/06/2014, 02:20
Báo cáo khoa hoc:" Development and assignment of bovine-specific PCR systems for the Texas nomenclature marker genes and isolation of homologous BAC probes" ppt
... [12] The isolated BAC is currently being studied to conrm the presence of the VIL1 gene and to describe a specic coding sequence For BTA29, as LDHA could not be assigned to the somatic cell hybrid ... step of 2.3 Sequencing The sequencing reactions were performed on the PCR products directly using a Dye Terminator kit (Perkin Elmer) For IGH@, the PCR product was cloned in the vector PGEMT (Promega) ... structure For CSN10 and LGB we used previously described primer pairs (see reference or Accession number in Tab I) 2.2 PCR conditions PCR reactions were performed on an MJ Research PTC-100 thermocycler...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo y học: "The Proteomic Code: a molecular recognition code for proteins" docx
... be complementary to each other - The physico-chemical characteristics of the coded and interacting amino acids are determined mainly by the 2nd (central) codon residues - The physico-chemical ... properties – size, charge and hydrophobicity – and constructed size, charge and hydropathy compatibility indices (SCI, CCI, HCI) and matrices (SCM, CCM, HCM) Each index characterized the expected strength ... nucleic acids and proteins; (c) nucleic acid structure determines the amino acid co-locations; (d) as a consequence, amino acids encoded by the interacting (partially reverse complementary) codons...
Ngày tải lên: 13/08/2014, 16:21
The toyota way model an implementation framework for large chinese construction firms
... Bureau CCTV Closed-circuit Television CI Corporate Image CII Constuction Industry Institute CICA China International Contractors Association CICC Chinese International Construction Company COE Collective-owned ... production, which occupies a rather central place in economics (Coombs et al., 1987) The neoclassical theory of production concerns the first aspect of production management, which focuses on the relationships ... management The socio-technical system The concept of the organization as a “socio-technical” system is concerned with the interactions between the psychological and social factors and the needs and...
Ngày tải lên: 08/09/2015, 19:40
INTERNATIONAL CODE FOR THE CONSTRUCTION AND EQUIPMENT OF SHIPS CARRYING DANGEROUS CHEMICALS IN BULK (IBC CODE)
... THE INTERNATIONAL CODE FOR THE CONSTRUCTION AND EQUIPMENT OF SHIPS CARRYING DANGEROUS CHEMICALS IN BULK (IBC CODE) ∗ The complete text of the IBC Code is replaced by the following: “Preamble The ... excluded from the cargo area 1.3.7 Cargo pump-room is a space containing pumps and their accessories for the handling of the products covered by the Code 1.3.8 Cargo service spaces are spaces ... to the nature of the products involved The basic philosophy of the Code is to assign, to each chemical tanker, one of the ship types according to the degree of the hazards of the products carried...
Ngày tải lên: 25/04/2016, 09:00
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... GAGCCAATATCAAATCTGGTGGTAATCC GAGGAACAAAAATAGTACCGGTAATAAC GTAAGCCTGGAACTCTTTGT GTCAAACCTTGAGAAAGAAC GTTCTTTCTCAAGGTTTGAC ACAAAGAGTTCCAGGCTTAC CAAATCTATGATTTCTTAAGGGCCA AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA ... ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGTAATCC ... CAAAGCGATCTTATTCTTTT AGCGTAATCTGGAACGTC ACTACGTATCACGACAAACCAACAGCCG TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT...
Ngày tải lên: 18/02/2014, 06:20
RENEGADES WRITE THE RULES doc
... and dictate the expectations (at least for a season—more on that later) The tool they offer is crowdsourcing RENEGADES WRITE THE RULES It points to the crowd as the key resource, which it is The ... respect to the accuracy or completeness of the contents of this book and specifically disclaim any implied warranties of merchantability or fitness for a particular purpose No warranty may be created ... Ever, which came after winning three straight NBA titles with the Lakers, and then L .C. L for Last Center Left, a comical nod to his claim that he was the last true center in the NBA Then there was...
Ngày tải lên: 16/03/2014, 07:20
Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx
... 5¢-CATAGGTCCACTGCTGGCCAAAGCTGTCCTCCACATCG-3¢ Tyr895fiTrp 5¢-CGATGTGGAGGACAGCTGGGGGCAGCAGTGGACC-3¢ Second primer 5¢-GGTCCACTGCTGCCCCCAGCTGTCCTCCACATCG-3¢ a Silent mutations produce a diagnostic ... 5¢-GTGGAGGACAGCTATGGGCAGCAGTGG-3¢ Tyr895fiCys 5¢-GTGGAGGACAGCTGTGGGCAGCAGTGG-3¢ Second primer 5¢-CCACTGCTGCCCACAGCTGTCCTCCAC-3¢ Tyr895fiPhe 5¢-CGATGTGGAGGACAGCTTTGGCCAGCAGTGGACCTATG-3¢ b Second primer ... Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ a Second primer for all of the above 5¢-GTCATTAATCCAACGGTCATCCCA-3¢ Primers used for mutations by PCR and the QuikChangeTM Site-Directed Mutagenesis Kit...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... relaxation of the scDNA Synthetic 20 mer oligonucleotides (ODNs), the speci c 5¢-AGACATGCCTAGACATGCCT-3¢ (CON) and nonspeci c 5¢-GCATCATAGCGCATCATAGC-3¢ (NODN), including their complementary ... the p53 CTDBS is primarily responsible for the p53 SCS DNA binding On the other hand, the ability of the p53 CD to recognize some DNA conformational motifs, including those characteristic for negatively ... ICA-9, respectively, but no p53 (C) Graph showing the effects of Bp53-10.1 or ICA-9 concentration on relative bound fraction of scDNA [data calculated from densitometric tracing of the free scDNA...
Ngày tải lên: 30/03/2014, 15:20
Lift in Action: The Simply Functional Web Framework for Scala potx
... describes the purpose of each section The src directory contains everything that directly contributes to the application’s functionality Table 2.4 Directories created in the SBT project Directory ... the code for the examples in the book from the publisher’s website at www.manning.com/LiftinAction Code annotations accompany many of the source code listings, highlighting important concepts ... generated project structure and the functions of the main components of the source tree PROJECT DIRECTORY Working from the root folder through the project tree, you should see the project directory This...
Ngày tải lên: 30/03/2014, 17:20
Báo cáo hóa học: " Uniqueness of the potential function for the vectorial Sturm-Liouville equation on a finite interval" doc
... H) then the characteristic function of Lm(Q, h, H) is (λ) = C ∞ i=1 (1 − λ mi ) λi where C is determined by {(li, mi)}i = 1,∞ This means that the spectral data determined the corresponding characteristic ... denotes the jth column of (V(L)) for a m × m matrix L Similarly, we denote Ω ij (l) the characteristic function of the real symmetric problem Lm (Q, h + (B(i, j) + B(j, i)), H) for ≤ i, j ≤ m, then ... of Electronic Engineering, China University of Science and Technology, No.245, Academia Rd., Sec 3, Nangang District, Taipei City 115, Taiwan, PR China Authors’ contributions Both authors contributed...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: "Research Article An Inequality for the Beta Function with Application to Pluripotential Theory" doc
... Ω ⊆ Cn is hyperconvex if there exists a plurisubharmonic function ϕ : Ω → −∞, such that the closure of the set {z ∈ Ω : ϕ z < c} is compact in Ω, for every c ∈ −∞, ; that is, for every c < the ... and Applications Since Euler’s days the research of these special functions and their generalizations have had great impact on, for example, analysis, mathematical physics, and statistics In this ... some completely monotonic functions,” Journal of Mathematical Analysis and Applications, vol 324, no 2, pp 1458–1461, 2006 F Qi, R.-Q Cui, C. -P Chen, and B.-N Guo, “Some completely monotonic functions...
Ngày tải lên: 22/06/2014, 02:20
He didn''''t write (THE PAST TENSE) potx
... TỪ BẤT QUY T C Có nhiều động từ thu c dạng 'bất quy t c' Chúng hình thành dạng khứ theo c ch kh c Ta c c ch phải h c thu c Hãy nhìn động từ to be Present Past is was am were are Chú ý động từ ... Australian family CHÍNH TẢ C A C C ĐỘNG TỪ KẾT TH C BẰNG Y Một số động từ kết th c y: đổi y thành i trư c thêm ed hurry marry study worry hurried married studied worried C c động từ kết th c ay hay oy ... ANNE They don’t know where he went Quá khứ write wrote I write these examples I wrote you an email ANNE He wrote every week, and then the letters stopped Quá khứ come came I want you to come to the...
Ngày tải lên: 12/07/2014, 03:20