wolbachia bacteria play a key role

... 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ activated at 95°C for 10 minutes followed by 45 cycles of denaturing at ... 81 NM_031512 Forward: 5’-ATATGTTCTCAGGGAGATCTTGGAA-3’ 80 NM_031512 Reverse: 5’-ACGGGTTCCATGGTGAAGTC-3’ IL-6 Reverse: 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 ... Animal work and handling were complied with the National Health and Research Council (Australia) Code of Practice for Animal Care in Research and Teaching (2004) [13] RNA extractions Total RNA was...

Ngày tải lên: 09/08/2014, 08:22

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... 51SufI-BamHI-rv (5¢-ACGCGGATCCAG TCATAAACAGCGGTTGC-3¢, BamHI site underlined), 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT ... Tat apparatus FEBS Lett 534, 156–160 Miller, J.H (1992) A short course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria Cold Spring Harbor Laboratory...

Ngày tải lên: 07/03/2014, 16:20

... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applications to DNA packaging, ... cycle, particularly the S-phase [21] Temperature is an additional factor capable of affecting DNA conformation It has been reported that (a) an increase of a few °C is associated with a reduction ... Luccia A (2002) Polyamines interact with DNA as molecular aggregates Eur J Biochem 269, 4317–4325 30 Saminathan M, Antony T, Shirahata A, Sigal LH, Thomas T & Thomas TJ (1999) Ionic and structural...

Ngày tải lên: 23/03/2014, 15:20

... Germany) The samples were separated using a solvent of chloroform/ methanol/water (65 : 35 : 7, v/v/v) Authentic lipid standards (Avanti Polar Lipids, Alabaster, AL, USA) were separated alongside ... the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems Multiskan plate reader using the absorbance difference, A4 50 )A5 40 Detection of human TNF -a mRNA by NASBATM TNF -a ... confirm that MonoMac-6 cells can be used as a model for peripheral blood monocytes and that the acyltransferase LPCAT plays a significant role in the production of TNF -a and IL-6 in LPS-stimulated...

Ngày tải lên: 31/03/2014, 01:20

... EDTA at 35 °C In this tetramer, even if freshly prepared, the a- peak (at 577 nm) was always lower than the b-peak (at 541 nm) with an absorbance ratio of a/ b ˆ 0.90, this being in contrast to a ... stable and more loosely packed than its a1 b1 counterpart in HbO2 At all rates, the present spectral examinations clearly indicate that the formation of the a1 b1 or a2 b2 contact suppresses remarkably ... the stability of human HbO2, we have used this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner...

Ngày tải lên: 31/03/2014, 15:20

... bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs from different but homologous gene segments present in a ... AY582061 PB2 B/Norway/1/84 AF101984 HA B/Memphis/5/93 AF129902 NA B/Memphis/3/93 AF129915 Putative Parents 3SEQ p-value Breakpoint Δ c-AIC B/Shiga/T30/98 B/Alaska/03/1992 B/Guangdong/05/94 B/Chile/3162/2002 ... were derived by plaque purification Furthermore, the same laboratory was the source for all four recombinants and the one putative parental strain As suggested in influenza A virus [9], further...

Ngày tải lên: 20/06/2014, 01:20

... of mass media such as radio, TV is very limited in Bangladesh especially in rural areas as compared to urban areas, some additional programs such as face-to-face communication and sexual education ... population research and Training), Mitra and Associates and ORC Macro In 'Bangladesh Demography and Health Survey 1999–2000' Volume Dhaka and Calverton: NIPORT, Mitra and Associates and ORC Macro; ... monitoring and evaluation regarding AIDS awareness In this regards a few national and international researchers have made attempts to understand the reasons and come up with some explanations [12,17,18]...

Ngày tải lên: 10/08/2014, 05:20

... altered sulphate compartmentalization BMC Plant Biol 2010, 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate ... SULTR1.1 and SULTR1.2, in Arabidopsis Plant Physiol 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant ... Devaiah BN, Madhuvanthi R, Karthikeyan AS, Raghothama KG: Phosphate starvation responses and gibberellic acid biosynthesis are regulated by the MYB62 transcription factor in Arabidopsis Mol Plant...

Ngày tải lên: 11/08/2014, 11:21

... each ripening stage of RH and RHB The variable set was made of the major 41 volatile aroma compounds PCA involves a mathematical procedure that transforms a number of possibly correlated variables ... Plant Physiol 2009, 166:1241-1252 Han SY, Kitahata N, Sekimata K, Saito T, Kobayashi M, Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K, Yoshida S, Asami T: A novel inhibitor of 9-cis-epoxycarotenoid ... with maxima in the range of hundreds of μg/g fresh weight The two genotypes displayed similar ripening-associated patterns for aromatic and branched chain amino acid-, fatty acid-, and furanrelated...

Ngày tải lên: 11/08/2014, 11:21

... 65:1671-1672 Nakano K, Okada Y, Saito K, Tanikawa R, Sawamukai N, Sasaguri Y, Kohro T, Wada Y, Kodama T, Tanaka Y: Rheumatoid synovial endothelial cells produce macrophage colony-stimulating factor leading ... clinical improvement in three refractory cases Ann Med 2003, 35:362-367 10 Koyama K, Hatsushika K, Ando T, Sakuma M, Wako M, Kato R, Haro H, Sugiyama H, Hamada Y, Ogawa H, Nakao A: Imatinib mesylate ... growth factor receptor; PsA: psoriatic arthritis; RA: rheumatoid arthritis; RANKL: receptor activator of nuclear factor-kappa-B ligand; TNF: tumor necrosis factor; TRAP+: tartrate-resistant acid...

Ngày tải lên: 12/08/2014, 11:23

... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... (Hertfordshire, UK) Statistical analysis Averaged data are presented as mean ± sem Where appropriate, statistical significance was assessed by unpaired Students T tests or one-way ANOVA followed by the...

Ngày tải lên: 12/08/2014, 16:20

... the Lao PDR; Lao Securities Exchange; Lao Statistics Bureau Malaysia Bursa Malaysia; SME Corporation; Bank Negara Malaysia Mongolia Bank of Mongolia; Credit Guarantee Fund of Mongolia; Financial ... Corporation; Bangladesh Bureau of Statistics; Palli Karma Sahayak Foundation; Bangladesh Ventures Cambodia Cambodia Securities Exchange; National Institute of Statistics; National Bank of Cambodia ... China and the Republic of Korea in East Asia; (iii) Bangladesh, India, and Sri Lanka in South Asia; (iv) Cambodia, Indonesia, Malaysia, the Philippines, Thailand, and Viet Nam in Southeast Asia;...

Ngày tải lên: 08/09/2015, 23:32

... (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, 10 · reaction ... Luria–Bertani broth and isopropyl thio-b-d-galactoside were purchased from USB (Cleveland, OH) Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl2, NaCl and ... wild-type and ‘not detectable’ for W14 0A and W140O) Flanagan et al [15] reported that multiple mutations can cause large changes in the average conformation of denatured proteins Here we show that a...

Ngày tải lên: 20/02/2014, 01:20

... part be achieved by microarray analysis to identify mRNAs that are translated or remain untranslated under different conditions in a given cell type Microarray analyses have already been valuable ... Okabe, K., Nozoe, Y., Fukuhara, S., Morino, S., Ishida, T., Taniguchi, T., Hasegawa, H., Terashima, A. , Sasaki, M., Katsuya, Y., Kitamura, K., Miyoshi, H., Ishikawa, M & Miura, K (2002) Crystal ... internal fragment by caspase-3-mediated cleavage Cell Death Differ 7, 628–636 23 Tee, A. R & Proud, C.G (2000) DNA damage causes inactivation of translational regulators linked to mTOR signalling...

Ngày tải lên: 23/03/2014, 21:20

... 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated cleavage at an N-terminal ... 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the plasmids into T-REx 293 ... morphogenic transitions and regulation of A1 2L proteolysis Conclusion By demonstrating that A1 2L protein and its cleavage at an N-terminal AG /A play an important role in viral replication, we were able...

Ngày tải lên: 18/06/2014, 18:20

... 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated cleavage at an N-terminal ... 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the plasmids into T-REx 293 ... morphogenic transitions and regulation of A1 2L proteolysis Conclusion By demonstrating that A1 2L protein and its cleavage at an N-terminal AG /A play an important role in viral replication, we were able...

Ngày tải lên: 20/06/2014, 01:20

... critically and given the final approval, JYH has contributed in acquisition of data and analysis and interpretation of data; and KPV and NM have contributed in revising the manuscript critically All ... plate [31] Eular’s Law of viscoelastic buckling of a spine in the coronal and transverse planes Page of leading to a lateral bend and axial rotation/torsional buckling, respectively is a mechanical ... spinal column play a role to balance? An observation with literature review Journal of Orthopaedic Surgery and Research 2010 5:80 Submit your next manuscript to BioMed Central and take full advantage...

Ngày tải lên: 20/06/2014, 04:20

... TDR values, we used a daily soil water balance model We assumed the topsoil water to be only influenced by infiltrated rainfall and soil evaporation Soil evaporation was calculated in two stages: ... to dry treatment Strong interannual variability affected autumnal recharge As a consequence, winter field capacity could be reached early, as in 1999 and 2000, or very late as in 2001 and 1998 ... J.C., Ba Than U., Abiotic controls of soil respiration beneath an eighteen-year-old Pinus radiata stand in south-eastern Australia, J Ecol 76 (1988) 654–662 [10] Casals P., Romanya J., Cortina J.,...

Ngày tải lên: 08/08/2014, 01:21

... wall degradation and modification during programmed cell death in lace plant, Aponogeton madagascariensis (Aponogetonaceae) Am J Bot 2007, 94:1116-1128 Gunawardena AHLAN: Programmed cell death ... 44:245-253 Fakuda H, Watanabe Y, Kuriyama H, Aoyagi S, Sugiyama M, Yamamoto R, Demura T, Minami A: Programming of cell death during xylogenesis J Plant Res 1998, 111:253-256 Gunawardena AHLAN, Greenwood ... madagascariensis; Aponogetonaceae) leaf model system Am J Bot 2009, 96:865-876 Elliott A, Gunawardena AHLAN: Calcium inhibition halts developmental programmed cell death in the lace plant, Aponogeton...

Ngày tải lên: 11/08/2014, 11:21

... sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in ... critical reading of the manuscript and Stacia Sloane for assistance in data analysis This research was funded by USDA Agricultural Research Service CRIS Project 5325-43000-026-00D Mention of a specific ... analyses and contributed to experimental design All authors analyzed MS/MS data and have read and approved the final manuscript Received: 25 July 2009 Accepted: 11 January 2010 Published: 11 January...

Ngày tải lên: 12/08/2014, 03:21