within a worksheet and between workbooks
báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx
... copper amalgam? In what year did all your use of copper amalgam end* Have you worked with amalgam that was manually mixed in a mortar? yes-no Have you ever manually weighted mercury and alloy and ... in a mortar? If yes: In that case, when and for how many years? From year to year Have you mixed amalgam in a Dentomat? Yes-no Did you use a Dentomat (semi-automatic device) to prepare amalgam? ... the participants started and ended the use of copper amalgam and Dentomat was analyzed by calculating the mean difference from the absolute values of the difference between the pairs, standard...
- 8
- 422
- 0
Báo cáo y học: "A possible link between exercise-training adaptation and dehydroepiandrosterone sulfate- an oldest-old female study"
... conditions, ATP demands are immediately increased Carbohydrate fuel, as an anaerobic substrate, has the advantage of having a fast degradation rate and can occur in the absence of oxygen for rapid ATP ... on an ELISA analyzer (Tecan Genios, Salzburg, Austria) with the use of commercially available ELISA kits (Diagnostic Systems Laboratories, Inc Webster, Texas, USA), according to the manufacture’s ... according to the manufacturer’s procedures BP, HR, and arterial oxygen saturation BP and HR were measured quietly and at constant temperature (~ 23°C) Participants were provided with an automated oscillometric...
- 7
- 338
- 0
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese
... singular form (of a noun of a particular class), and ‘teachers’ is plural form (of a noun of a particular class); and the difference between singular forms and plural form is semantically relevant: ... contrastive, not comparative) two values typologies (a CA is always concerned with a pair of languages), and founded on the assumption that languages can be compared.” CA describes similarities and ... • What are the grammatical and semantic features of each verb and how are they similar and different in terms of these features? • What are their synonyms and idioms? • What are the implications...
- 52
- 1,860
- 25
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...
- 9
- 796
- 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... (2001) The Rad51 and Dmc1 recombinases: a non-identical twin relationship Trends Biochem Sci 26, 131–136 Namekawa SH, Iwabata K, Sugawara H, Hamada FN, Koshiyama A, Chiku H, Kamada T & Sakaguchi K ... Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation of a meiosis-specific RecA homolog, Lim15/Dmc1, via interaction with the small ... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG...
- 10
- 487
- 0
Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
... P"~OMINAL POST-NOMINAL modifier DISASTER4 REAson S~I War WAR ADG and usual case semantics coincide with factual meaning WAR resulted in disaster REAson DISASTER "" REAson~ "~'~REAson2 / F&CT1 WAR ... hierarchy for concept generalization Atomic f o r m u l a i n FTABLE and THESAURUS Knowledge Base consists of LEXICON, THESAURUS and FTABLE The case grammar, as a basis of internal representation, ... special combination of concepts like WAR with DISASTAR They play a role to match syntagmatic relation with semantics in terms of syntax These two processes analize the pragmatic, modal, and temporal...
- 7
- 373
- 0
Báo cáo khoa học: "All Words Domain Adapted WSD: Finding a Middle Ground between Supervision and Unsupervision" pptx
... just 30% of the target data to the source data achieved the same performance as that obtained by taking the entire source and target data Agirre and de Lacalle (2009) reported a 22% error reduction ... Comparing random strategy with oracle based ideal strategy for SemCor to Health adaptation Figure 6: Comparing random strategy with oracle based ideal strategy for SemCor to Tourism adaptation ... Research in Computational Linguistics, pages 19–33 Mitesh Khapra, Sapan Shah, Piyush Kedia, and Pushpak Bhattacharyya 2010 Domain-specific word sense disambiguation combining corpus based and...
- 10
- 337
- 1
Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx
... Santos and collaborators, comparing data between 2001 and 2003 with data between 1991 and 1993, in a city of the state of Santa Catarina, has shown an increase in the number of cases of HIV/AIDS ... Cruz and collaborators, in which the mean age was 41.08 and standard deviation was 14.32 years (Cruz et al., 2008) Silveira and collaborators observed similar results, obtaining a mean age of ... metachromatic cells 0.04% and epithelial cells 4.4% Female gender and atopy are associated with a significant elevation of eosinophils, male-to-female ratio was 0.3% and between atopic and non-atopic...
- 7
- 392
- 0
Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf
... from Mandarin than other regions in Mainland China One can easily spot Cantonese dialect articles in Hong Kong newspapers which are totally unintelligible to Mandarin speakers, while Mandarin articles ... J., Tomita M and Goodman K (1992) Machine Translation: A Knowledge-Based Approach Morgan Kaufmann Publishers, San Mateo, California, USA Sinclair J (1991) Corpus, Concordance and Collocation Collins, ... Design and Implementation A rudimentary design of a Cantonese-Mandarin dialect MT system has been made, as shown in Figure The system takes Cantonese Pinyin sentences as input and generates Mandarin...
- 5
- 438
- 0
![Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt](https://media.store123doc.com/images/document/14/rc/tl/small_tlm1396203606.jpg)
Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt
... 5¢-GTAGGACATGCCAGAggcGCCCCCTTG ACG-3¢, MOslr1417-3 5¢-GCAAACTTTTCCGaTCGgc GATAATCTGAAAACC-3¢, MOslr1417-4 5¢-GGAT TTACCACAACCAgctGTTTGATTAGCATT-3¢ and MOslr1417-5 5¢-CCAAAGGATTTACCggcgCCACAGG ... thaliana IscA1) AC007067.4, P_purp (Porphyra purpurea) NP_053827, Athal2 (Arabidopsis thaliana IscA2) AC005825.3, Athal3 (Arabidopsis thaliana IscA3), AC006921.5, A_ vinIscA (Azotobacter vinelandii ... slr1417 was amplified from chromosomal DNA of Synechocystis PCC 6803 by PCR using the primers PRiscA11 (5¢-GGAATTCCATATGAGCCAAGCCACC GCTACC-3¢) and PRiscA12 (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢)...
- 10
- 447
- 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot
... the anaerobic reaction between FNRrd and Adxox using a constant FNR concentration and increasing [Adxox]/[FNRrd] ratios (A) Time-course for the anaerobic reaction between FNRrd and Adxox as followed ... reoxida- Fig Time-course and kinetic data for the anaerobic reaction between FNRox and Adx(4–108)rd as followed by stopped-flow (A) Transients obtained at 600 nm and at [Adxox]/[FNRrd] ratios: ... interactions between Fd and FNR and Adx and AdR, ET from FNR to Adx is also detectable Thus, in both, Fd/FNR and Adx/AdR, systems it has been found that the single replacement of a residue can...
- 10
- 400
- 0
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... transition of calf thymus DNA and its complexes with ActII/ActV determined from DSC measurements All thermodynamic parameters are calculated per mol of DNA base pairs DH and DS, as well as DHbind and DSbind ... Table Binding parameters for ActII/ActV drug–DNA complexation, calculated per mol of ligand at r = 0.33 (ratio of moles of bound ligand to moles of base pairs) Values are mean ± average deviation ... mitoxantrone, ametantrone and its derivatives have shown [9] that variations in the structure –DSbind (calÆmol)1ÆK)1) – DGbind (kcalÆmol)1) ActII–DNA ActIII–DNA ActIV–DNA ActV–DNA Fig Heat absorption...
- 8
- 331
- 0
taking shape - a new contract between architecture and nature
... humankind’s expulsion from the Garden Woman was blamed for the Fall, the fall of nature as much as of ‘man’, as what was once gentle and immortal became hostile and ultimately fatal We die, and ... (Plate 6): In the garden we are in the space of nature and culture, form and matter, concrete and abstract, exterior and interior And, significantly, we are in a space of the feminine and the masculine ... to Hyde Park as nature We say certain acts are not ‘natural’, and speak authoritatively about what ‘nature intended’ Ecologists describe an empirically measured nature, and poets and explorers...
- 236
- 485
- 0
Báo cáo sinh học: "Developing a theoretical relationship between electrical resistivity, temperature, and film thickness for conductors" pptx
... Equation Using experimental data from other researchers, Equation can be viewed as a curve fit with c and κ ′ (or equivalently η) as adjustable parameters Again, a good match between experimental ... experimental and theoretical data will demonstrate that the theoretical model is reliable and valid The parameters for the theoretical model that are needed to generate data (and thus compare with ... complexity (and make the equation easier to analyze), and as a result, the accuracy decreases, or these papers introduce additional variables (to account for specific scattering effects) to increase accuracy,...
- 26
- 376
- 0
Báo cáo hóa học: " Research Article A Study of Residue Correlation within Protein Sequences and Its Application to Sequence Classification" pptx
... Morgan Kaufmann Series in Data Management Systems, Morgan Kaufmann, San Francisco, Calif, USA, 2nd edition, 2005 T M Cover and P Hart, “Nearest neighbor pattern classification,” IEEE Transactions ... 3.5 MIV examples Table shows eight examples of MIVs calculated from the Pfam database A sequence was taken from four random families, and the MIV was calculated using the literal gap method for ... specific classification accuracy We used the Pfam -A dataset to carry out this comparison The families contained in the Pfam database vary in sequence count and sequence length We removed all families...
- 9
- 374
- 0
Báo cáo sinh học: "A balancing act between the X chromosome and the autosomes" ppsx
... that has three copies in Dp/+ flies and one in Df/+ flies) female soma and gonads; that is, the expression ratios between X chromosomes and autosomes of XX;AA female soma and X;AA male soma centered ... sexes are hypertranscribed relative to autosomes, but also that the two X chromosomes of females are repressed, as the expression ratios of not only testes (X;AA) but also XX;AA ovaries and X;AA ... X-linked partner would Expression level 1.5 X X A X A X 0.5 X A A X X X A A X Xa A X A X A X Xi Soma Germline Drosophila Soma C elegans Soma Germ cells Mammals Figure Dosage compensation occurs...
- 3
- 315
- 0
Báo cáo toán học: "A simple bijection between binary trees and colored ternary trees" pot
... T1 and T2 , annex a left child v ′ to v and take T1 and T2 as the left and right subtrees of v ′ respectively See Figure 1(b) for example It is clear that any T ∈ Tn , after Step and 2, generates ... vertex u such that uP or P u forms an L-path Clearly, a leaf can never be R-path or L-path Note that the definition of L-path is different from that of R-path Hence, if P is a maximal R-path, then (1) ... is called a maximal R-path if there exists no vertex u such that uP or P u forms a R-path P is called an L-path, if k and vi is the left child of vi−1 for i k P is called a maximal L-path if there...
- 5
- 261
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25