... isolated AECII from human pulmonary pieces are rather difficult to obtain The aim of the study was to compare both models and to define the most suitable one to study antigen presentation In this ... [35] Therefore, we suggest that both CD58 and CD54 could play a major role in the antigenic presentation by AECII and that these cells could be able to present antigens to both CD4+ and CD8+ T lymphocytes ... analyzed first on resting cells and then on cytokine-activated cells To mimic inflammation, we chose to analyze the effect on the AECII phenotype of two major inflammatory cytokines, IFN-g and TNF-a,...
Ngày tải lên: 12/08/2014, 13:22
Ngày tải lên: 27/03/2014, 12:20
Unequal, Unfair, Ineffective and Inefficient Gender Inequity in Health: Why it exists and how we can change it pptx
... affirm the primary obligation of states to guarantee these rights Of particular note for this report are Principles 17 (the right to the highest attainable standard of health) and 18 (the right to ... their current relevance, scope, rapidity, and interactions with gender How these processes interact with gender systems of power and stratification, and to what extent and in what ways they weaken ... public discourse about it begins to change 23 Sometimes this generates a backlash from within existing power structures, together with attempts to return to the status quo ante (Faludi, 1992) V.1.2...
Ngày tải lên: 28/03/2014, 12:20
fisher - crashes, crises, and calamities; how we can use science to read the early-warning signs (2011)
... experiments did not produce a statistically significant positive result until Soal thought to check out the correlation between the guesses and the card after the one that the first subject had looked ... Swans”* and argues that we cannot extrapolate from past experience to predict them The best we can is to create suitable conditions for them to happen (or not to happen, as the case may be) Taleb ... best guess seems to be that the buttresses were so thin that the resulting structure was simply able to flex and either broke directly or vibrated itself to pieces in a high wind (This was not the...
Ngày tải lên: 01/11/2014, 13:17
How Our Actions Create our reality ... and how we can change it
... means that we often have the power to alter structures within which we are operating However, more often than not, we not perceive that power In fact, we usually don 't see the structures at play ... others; and then say that this it is to which the activity is due; and these are its laws But, the human intellect not only refuses to believe in that explanation, but flatly declares that the ... understand that when we use the term "systemic structure" we not just mean structure outside the individual The nature of structure in human systems is subtle because we are part of the structure This...
Ngày tải lên: 17/10/2013, 18:20
The What, Why and How of Sys Admin
... that must be performed regularly Automate, automate and automate A priority for a Systems Administrator must be to automate any task that will be performed regularly Initially automation may take ... liable to be another two to three days lost trying to fix the problem Records of everything done to the system must be kept and they must be accessible at all times What type of records? It is typical ... information, the interested user can learn a lot Unfortunately it's often the disinterested user that you really want to reach People often come to my office to ask me things You'd think that face -to- face...
Ngày tải lên: 19/10/2013, 02:20
Tài liệu TRADE:INSTITUTIONS AND IMPACT- Why and how do countries trade? pdf
... Fulbright Economics Teaching Program 2006-2007 Trade: Institutions and impact Lecture Course outline • First part: WTO and “traditional” trade policy Global trade institutions GATT and WTO WTO and ... Problems with strategic trade policy • • • • • Will hurt other industries Not consistent with WTO: trade partners may retaliate Domestic interest groups will spend lots of money to be next in line ... effects may be determined by history and chance Strategic policy intervention may decide where the next cluster is located • Protection of the local market and support to exporters may influence the...
Ngày tải lên: 09/12/2013, 20:15
Báo cáo "Academic English at tertiary level: What, why and how " pptx
... s/he get straight into the topic and seem interested in it, and make the reader interested in it? Sense of argument Is the argument set out clearly and logically and does the writer come to a clear ... work into paragraphs? Are the paragraphs in the right sequence and accurately linked together so the writing makes a coherent whole? Subject matter How well does the student deal with the topic? ... that refer to the writer or the reader This means that the main emphasis should be on the information that you want to give and the arguments you want to make, rather than you For that reason, academic...
Ngày tải lên: 14/03/2014, 11:20
Báo cáo y học: " Paediatric intensive care: the why and how for trainees" pdf
Ngày tải lên: 12/08/2014, 18:21
the student loan scam; the most oppressive debt in u.s. history and how we can fight back (2009)
... for the students Over time, legislators gave more support to the interests of the student loan companies and the federal government than to the interests of the students Bankruptcy protections, ... tice.org; I posted my research there and invited others to share their stories The purpose of SLJ was (and is) to convince Congress to restore standard consumer protections to student loans This ... customers Rather, it was a politically sophisticated corporation that lobbied its way to extreme profitability at the expense of students and taxpayers It used an unfair advantage bestowed on it...
Ngày tải lên: 30/10/2014, 16:59
marin - global pension crisis; unfunded liabilities and how we can fill the gap (2013)
... nineteenth century, the sea changed from agrarian to industrialized, and we saw the southern states bow to the might of the northern states In the twentieth century, we saw the Midwest Rust Belt get ... What I am is an aggregator of data, an integrator of knowledge, a translator of complexity and, more than anything, a storyteller The hedge fund story is easy to tell What student doesn t want to ... relevance of that factoid is that the private wealth category holds very little in retirement assets In fact, since I now want to start tallying those retirement assets, it would be very generous to assume...
Ngày tải lên: 01/11/2014, 18:45
wallison - privatizing fannie mae, freddie mac, and the federal home loan banks; why and how (2004)
... risk to the capital of the parent institution, the plan contemplates that the depository institution’s investment in an MHS will be fully deducted from the institution’s capital, so that it presents ... annually to assess the financial condition of each Bank and the System without regard to any ties of the Bank to other parts of the System or of the Banks and the System to the government, and to assess ... Section 208 Offset fund Requires the regulator to establish a fund and to allocate to that fund all fees and other payments by the enterprises pursuant to this Act; after creation of a nonprofit...
Ngày tải lên: 01/11/2014, 19:47
why and how do firms divest-
... information asymmetry rather than options to deal with high uncertainty A third important question is about the relative importance of information asymmetry and uncertainty to the decision to divest ... information asymmetry and uncertainty together to explore these relationships The third essay brings these two competing theoretical perspectives together and explores the dynamic relationships between ... relative explanatory power These hypotheses are tested using a probit model with selection correction This method takes the two decisions—the decision to divest and the decision to divest in a staged...
Ngày tải lên: 02/11/2014, 00:50
Sensorless Vector Control and Implementatio - Why and How (1)
... Motor #1 RX600 Motor Kit Implementation for Two Motor Control Software Implementation Control loop executed at Timer underflow interrupt Both interrupts at same priority level Alternate ... Current Transformation to 2-ph Rotor Frame Step : 3-ph to 2-ph conversion Step : 2-ph stationary frame to 2-ph rotor frame (rotating) Rotor position (θ) needed αβ stationary frame uvw stationary ... correction feedback loop – In-phase current = – Orthogonal current set per torque requirements What parameters to adjust Voltage magnitude (PWM duty cycle) Need to transform current vectors to...
Ngày tải lên: 22/06/2015, 14:19
báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf
... demonstrates that desensitization of neutrophils to stimulation by any two neutrophil CEACAMs allows the cell to respond to stimulation by the other two neutrophil CEACAMs However, neutrophils ... desensitization with two CD66 mAbs to further stimulation of neutrophil adhesion to HUVECs Cross desensitization with two CD66 mAbs to further stimulation of neutrophil adhesion to HUVECs TNF-stimulated ... significantly within min, and is no longer functional after 10 min, i.e the cell is desensitized to stimulation by that mAb [37] This observation allowed the current study to be performed This study...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc
... against the foreign antigen mBSA clearly demonstrates that their suppressive effect is not strictly limited to autoreactive T cells Taking into consideration that Treg cells are also critically ... intra-articular antigen challenge might be too late to inhibit activation of effector T cells and their migration to the joint Indeed, T- cell activation is an early event in AIA because CD4+ T cell ... of Treg cells [37] With this in mind, it could be interesting to investigate whether the accumulated Treg cells in patients with arthritis function properly in vivo and whether these patients...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells" ppsx
... 2-LTR circlea MH532 HIV F GAGTCCTGCGTCGAGAGAGC GTGCCCGTCTGTTGTGTGTGACT U5-U3 RNAa HIV R HIV F ACTGGTACTAGCTTGTAGCACCATCCA GTGCCCGTCTGTTGTGTGTGACT Gag HIV R For ACTGGTACTAGCTTGTAGCACCATCCA CCCATAGTGCAGAACATCCA ... T ATGCCACGTAAGCGAAACTCTGGCTAACT AGGGAACCCACTG TCCCAGCTACTGGGGAGGCTGAGG GCCTCCCAAAGTGCTGGGATTACAG ATGCCACGTAAGCGAAACT Linear HIV DNAa AA55M MH531 GCTAGAGATTTTCCACACTGACTAA TGTGTGCCCGTCTGTTGTGT ... ACTGGTACTAGCTTGTAGCACCATCCA CCCATAGTGCAGAACATCCA Singly splicedb Rev M669 GGGCTGAAAGCCTTCTCTTC GTGTGCCCGTCTGTTGTGTGACTCTGGTA AC GCCTATTCTGCTATGTCGACACC GACTCATCAAGTTTCTCTATCAAA La 23 Multiply spliced HIV RNAa...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "Endogenous TGF-β activation by reactive oxygen species is key to Foxp3 induction in TCR-stimulated and HIV-1-infected human CD4+CD25- T cells" docx
... secreted as its latent form (LAP-TGF-β), we first studied the total TGF-β protein (the supernatants were acid activated with HCl in vitro) TCRand CD28-stimulated CD4+CD25- T cells secreted TGF-β1 ... TCR and CD28 stimulation is to produce IL-2 that enables T cells to proliferate and differentiate into Th1 and/ or Th2 cells to mount specific immunity [19] Afterwards, a suppressive factor, TGF-β, ... as to how latent TGF-β is activated The finding that TGF-β is produced/secreted at the late stage of T cell activation, following maximal secretion of most Th1 and Th2 cytokines, may resolve the...
Ngày tải lên: 13/08/2014, 05:22
Regulation of antigen presentation in dendritic cells
... antigen to CD4+ T cells In turn, the CD4+ T cells stimulate the B cells to grow into plasma B cells that produce antibodies In fact, the antigen presentation by B cells is intimately linked to ... ability to internalise, process and present antigens to T cells The presentation of peptides to the antigen receptor on CD4+ T helper lymphocytes is mediated by the major histocompatibility complex ... proteins interacting with CARD However, the study cannot rule out the possibility that the higher transactivation activity of DC-CIITA can be attributed to more efficient nuclear translocation and...
Ngày tải lên: 11/09/2015, 16:05
Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt
... control group (P > 0.9, by Student’s t- test), between the age of the SLE patient group and the corresponding healthy control group (P > 0.9, by Student’s t- test), and between the RA patient group ... correlate with disease duration or treatment in either RA or SLE patients (data not shown) Discussion The present study shows that the differentiation of peripheral blood CD8+ T cells is skewed ... perforin, secrete IFN-γ and tumor necrosis factor-α, are cytotoxic, and are capable of rapid effector function after stimulation [9–11] Table Patient profiles and characteristics Patient number/ sex/age...
Ngày tải lên: 09/08/2014, 01:21