which is a better major computer science or information technology

Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

... HPNAP_up (5Â-GCGGAA TTC CATATGAAAACATTTGAAATT-3Â) and HPNAP_ low (5Â-GCG GGATCCTTAAGCCAAATGGGCTTG-3Â), HPNAP_up (5Â-GCG GAATTCCATATGAAAACATTTG AAATT-3Â) and HPNAP_low (5Â-CCG CTCGAGAGCC AAATGGG-3Â), ... 157-up (5Â-GCG GAATTCCATATGAAAA CATTTGAAATT-3Â) and HPNAP 157-low (5Â-CCG CTC GAGCCTTTCAGCGA-3Â) (XhoI), and HPNAP 58144- up (5Â-GCG GAATTCCATATGATCGTTCAATTAGGA- 3Â)(EcoRI, NdeI) and HPNAP 58144-low ... 5Â-GGTGCCTTTCACA TTCCACGCGAAGTTATGCACTTTCAT-3Â,5Â-AATTTC TTCAGTGGCTTTCGCCACATTGAAAAAATCGGT-3Â, 5Â-GATCCTTTCAGCGAGATCCGCAAACATGTCCGC AAACTC-3Â and 5Â-TTGCAGCATCCAAATGGACGCTT GCAACTTGGCCAATTG-3Â for H2 5A, H3 7A, D5 2A and K13 4A, respectively. The PCR products...

Ngày tải lên: 30/03/2014, 04:20

16 352 0
Báo cáo y học: "Road trips and resources: there is a better way" pot

Báo cáo y học: "Road trips and resources: there is a better way" pot

... intrahospital transport. Using the statistical package Crunc h (Verion 4, CrunchSoftware,Oakland,California,USA),thethree groups were analyzed for differences using a one-way analysis of variance ... RESEARC H Open Access Road trips and resources: there is a better way Sandra Swoboda 1 , John A Castro 2 , Karen A Earsing 3 , Pamela A Lipsett 1 Abstract Background: Transport of critically ... a criti- cal care nurse, a physician and a respiratory therapist (if the patient is mechanically ventilated). Extra escort per- sonnel are required as necessary to transport additional equipment...

Ngày tải lên: 12/08/2014, 18:20

7 329 0
concrete mathematics a foundation for computer science phần 1 pdf

concrete mathematics a foundation for computer science phần 1 pdf

... Library of Congress Cataloging-in-Publication Data Graham, Ronald Lewis, 1935- Concrete mathematics : a foundation for computer science / Ron- ald L. Graham, Donald E. Knuth, Oren Patashnik. xiii,625 ... mathemat- ics was inferior and no longer worthy of attention. The goal of generalization had become so fashionable that a generation of mathematicians had become unable to relish beauty in the particular, ... hard one to the easy one. time to do warmup Let’s apply these ideas to a useful example. Consider the array exercises 4 and 6.) (Or to check out al al al a2 the Snickers bar a2 al a2 a2 languishing...

Ngày tải lên: 14/08/2014, 04:21

64 391 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

... synthesis and glycogen synthase activity, with a basal rate of flux at or near the plateau. The phosphorylase inactivator, CP-91149, caused both activation of glycogen synthase and translocation of ... glycogen synthesis by inactivation of phosphorylase is associated with both activation and translocation of glycogen synthase, and that the former mechanism alone cannot explain the stimulation of glyco- gen ... glycogen degradation or activation of glycogen synthase alone and suggests an additional role for translo- cation of synthase. Titrations with the phosphorylase inac- tivator showed that stimulation...

Ngày tải lên: 31/03/2014, 01:20

9 381 0
Tài liệu Unit 1- What is a computer? pptx

Tài liệu Unit 1- What is a computer? pptx

... information, perform mathematical and /or logical operations then supply new information. 2. All computers have three basic capabilities. 3. A computer is a machine that can be made to operate ... magnetized or demagnetized. The machine is capable of storing and manipulating numbers, letters, and characters. The basic idea of a computer is that we can make the machine do what we want ... reason, computer can be defined as devices (thiết bị?) which( 2) ( !devices) accept information in the form of instructions called a program and characters called data, perform mathematical and/or...

Ngày tải lên: 21/12/2013, 20:15

4 865 3
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... mid-way along the chain. Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and this was confirmed by analysis of the EST database; this showed significant ... was for 5 days. (C) Heart, kidney, lung and spleen RNA from each of three animals was analysed for Cyp4x1 RNA, and a 5-day exposure of the autoradiograph is shown; – and + represent yeast tRNA without ... recep- tor-alpha expression in human liver. Mol Pharmacol 53, 14–22. 35 Akiyama TE et al. (2001) Peroxisome proliferator-acti- vated receptor-alpha regulates lipid homeostasis, but is not associated with...

Ngày tải lên: 19/02/2014, 07:20

12 466 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. Platani. ... genomic databases using a tailor-made bioinformat- ics facility. The mascot search was run against all proteins and DNA sequence information from public databases V. Seidl et al. Epl1, a small secreted ... [e.g. cerato-platanin of Ceratocystis fimbriata f. sp. platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and path- ogenesis-related proteins (As-CG...

Ngày tải lên: 07/03/2014, 12:20

14 494 0
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx

Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx

... Tomioka, S., Sorimachi, H., Saido, T.C., Maruyama, K.,Okuyama ,A. ,Fujisawa-Sehara ,A. ,Ohno,S.,Suzuki,K.& Ishiura, S. (1999) Membrane-anchored metalloprotease MDC9 has an alpha-secretase activity ... 25–31. 37. Takahashi, S., Kasai, K., Hatsuzawa, K., Kitamura, N., Misumi, Y., Ikehara, Y., Murakami, K. & Nakayama, K. (1993) A mutation of furin causes the lack of precursor-processing activity in ... the disintegrin metalloprotease ADAM10. J. Neurochem. 76, 1532–1539. 41. Takahashi, S., Nakagawa, T., Kasai, K., Banno, T., Duguay, S.J., VandeVen,W.J.M.,Murakami,K.&Nakayama,K.(1995) A second...

Ngày tải lên: 08/03/2014, 02:20

8 422 0
Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

... intestine. Acknowledgements The author thanks Dr A. Iwamatsu (Central Laboratories f or Key Technology, Kirin Brewery Co. Ltd, Yokohama, Japan) for PMF analysis. References 1. G elman, L. & Auwerx, ... Expression o f p utative fatty acid tr ansporter g enes are regulated by p eroxisom e proliferator-activated receptor a and c activators in a tissue- and i nd ucer-specific manner. J. Biol. Chem. 273, ... examined the PPARa agonist-induced proteins in the intestine, another important organ for lipid metabolism e xpressing a fairly large amount of PPARa in mouse and human, to obtain new insight...

Ngày tải lên: 16/03/2014, 18:20

6 272 0
w