which has a homodimeric structure

... log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data area is ... purpose. The separate data area of these database systems means that they do not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space. The space occupied by the log in a database system ... grant CCR-8900029, and in part by the National Aeronautics and Space Administration and the Defense Advanced Research Projects Agency under contract NAG2-591. This paper will appear in the Proceedings...

Ngày tải lên: 12/09/2012, 15:05

Ngày tải lên: 25/10/2013, 21:20

...

Ngày tải lên: 26/01/2014, 08:20

... Read Button.Click Creates a DataSet and reads in the schema from a file containing a previously serialized XSD schema. The XSD schema is written from the DataSet to a stream and displayed. ... SchemaType.Source); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet. da = new SqlDataAdapter("SELECT * FROM [Order Details]", ... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.FillSchema(orderDetailTable, SchemaType.Source); da.Fill(orderDetailTable);...

Ngày tải lên: 26/01/2014, 10:20

... Vandoeuvre-Les-Nancy, France E-mail address : ammann@iecn.u-nancy.fr Universit ¨ at Mainz, Mainz, Germany E-mail address : lauter@mathematik.uni-mainz.de Pennsylvania State University, University Park, PA E-mail address ... Ammann, Robert Lauter, and Victor Nistor* Abstract We define and study an algebra Ψ ∞ 1,0,V (M 0 ) of pseudodifferential opera- tors canonically associated to a noncompact, Riemannian manifold M 0 whose geometry ... definition of a Rieman- nian manifold with a Lie structure at infinity and some of its basic properties. 1.1. Preliminaries. In the sequel, by a manifold we shall always understand a C ∞ -manifold possibly...

Ngày tải lên: 16/02/2014, 06:20

... Gln15 and the carbonyl oxygen atoms of Asp11 and Asn23 (Fig. 3) in an arrangement similar to what is observed in VPRK. Both PRK and VPRK have calcium bound at Ca3. SPRK also has an aspar- tic acid ... autocatalytically cleaved off when the enzyme has obtained its active conforma- tion, and the two C-terminal domains are cleaved off by heat treatment at 50 °C. An Ala-Pro-Thr sequence is located ... not reveal the classical cold adap- ted features [19], but still initial comparative studies showed that the catalytic turnover was at least twice that of PRK, but substrate affinity was reduced....

Ngày tải lên: 19/02/2014, 07:20

... 5720–5728. 12 Gao J, Katagiri H, Ishigaki Y, Yamada T, Ogihara T, Imai J, Uno K, Hasegawa Y, Kanzaki M, Yamamoto TT et al. (2007) Involvement of apolipoprotein E in excess fat accumulation and insulin ... in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice Eleni A. Karavia 1 , Dionysios J. Papachristou 2 , Ioanna Kotsikogianni 2 , Ioanna Giopanou 2 and Kyriakos ... mice, which showed heavy loading with fat. The reticulin stain is a classical histopathological mar- ker for the identification of hepatic architecture and structural damage within the liver parenchyma....

Ngày tải lên: 05/03/2014, 23:20

...

Ngày tải lên: 08/03/2014, 11:20

... it! BRIDGET and ANNIE Nick! BRIDGET Oh good, the washing’s done. [Snarls] Episode 3 Hector Has a Date 8 Episode 3 Narrative ANNIE [sending email] ‘Dear dream date. My name is Annie! I’m 19 and I love animals, and, ... million-aire? HECTOR Psst, psst! Am I a millionaire? NICK [Laughs] Are you a millionaire? Are you a millionaire? [Laughs] Ha! We are millionaires! BRIDGET and ANNIE Good – good. BRIDGET Well you can ... Nick, what about Bridget and Annie? NICK Aha! It’s not a problem! HECTOR [Laughs] Ah-ha-ha! Yes! ANNIE [sending email] ‘Nadia, it’s terrible news. Hector killed my plant with perfume!’ ANNIE Oh,...

Ngày tải lên: 15/03/2014, 17:20

... 271–280. 17 Cavada BS, Santos CF, Grangeiro TB, Moreira da Silva LIM, Campos MJO, de Sousa FAM & Calvete JJ (1997) Isolation and partial characterization of a lectin from Parkia platycephala Benth ... 18; Mimosoideae; Parkia platycephala; X-ray crystal structure Correspondence B. S. Cavada, BioMol-Laboratory, Departamento de Bioquı ´ mica e Biologia Molecular, Universidade Federal do Ceara ´ , Fortaleza, ... Pastuszak I, Drake R & Elbein AD (1996) Kidney N-acetylgalactosamine (GalNAc)-1-phosphate kinase, a new pathway of GalNAc activation. J Biol Chem 271, 20776–20782. 47 Ainouz IL, Sampaio AH,...

Ngày tải lên: 16/03/2014, 13:20

... AE, Goldberg JB & Dicesare TJ (1991) Hyaluronic acid capsule is a virulence factor for mucoid group A streptococci. Proc Natl Acad Sci USA 88, 8317–8321. 49 Kawabata S, Kuwata H, Nakagawa ... Morimatsu S, Sano K & Hamada S (1999) Capsular hyaluronic acid of group A streptococci hampers their invasion into human pharyngeal epithelial cells. Microb Pathog 27, 71–80. 50 Wibawan IW, Pasaribu ... HS:19 serostrain and have shown that these labile groups are an a- l-sorbofuranose branch attached at C2 of b-d-GlcA and a MeOPN modifica- tion located at C4 of b-d-GlcNAc. There are very few reports...

Ngày tải lên: 16/03/2014, 13:20

... morfologickdm/AANS6 1A zna~kov£nf/NNNS6 A (/z: n~kdy/Db t~/Db' zvandm/AAI_S6 IA morfologicko /A2 -/Z: syntaktickd/AAIP1 1A )/z: jazykfi/NNIP2 A s/RR 7 bohatou/AAFS7 1A flexf/NNFS7 ... Na~e/PSHS1-P1. metoda/NNFS1 A p~itom/Db. vyu~fvi/VB-S 3P-AA- exponenciilnfho/AAIS2 1A pravd~podobnostnfho/AAI $2 1A modelu/NNIS2 A zalo~endho/AAIS2 1A na/P~ 6 automaticky /Dg 1A ... yEY i 1 ~,Ve use a separate model for each ambiguity class AC (which actually appeared in the training data) of each of the 13 morphological categories 6. The final PAC (Yix) distribution...

Ngày tải lên: 17/03/2014, 07:20

... h20" alt=""

Ngày tải lên: 19/03/2014, 14:10

... (5¢-TTCAAAAGC ATAGTATCCATAGCTGAGTAAATACCACCTCTTG-3¢), and the pPICZaA-ScOCH1 as a template. The both D18 8A mutant and wild-type proteins were expressed as mentioned above. After the culture supernatants ... QuickChange II Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) by using two mutagenic primers, which were D18 8A- FW (5¢-CAAGAGGTGGTATTTACTCAGCTATGGATA CTATGCTTTTGAA-3¢) and D18 8A- RV ... putative transmembrane region was amplified by PCR with two primers, OCH1-FW (5¢- CTCGAGAAAAGACACTTGTC AAACAAAAGGCTGCTT-3¢; the XhoI site is underlined) and OCH1-RV (5¢- TCTAGACGTTTATGACCTGCATTT TTATCAGCA-3¢;...

Ngày tải lên: 23/03/2014, 10:20

... type 5¢-GTGGAGGACAGCTATGGGCAGCAG-3¢ Asp893fiArg 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg ... 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ Second primer for all of the above 5¢-GTCATTAATCCAACGGTCATCCCA-3¢ a Primers used for mutations by PCR and the QuikChange TM Site-Directed ... general, however, we can distinguish between catalytically inactive and catalytically active mutants. Catalytically inactive mutants All mutants of Asp893 and Gly896 were i nactive (Fig. 1) . Lack...

Ngày tải lên: 23/03/2014, 13:20

Ngày tải lên: 24/03/2014, 03:21

Ngày tải lên: 25/03/2014, 03:21

Ngày tải lên: 30/03/2014, 04:20

Ngày tải lên: 30/03/2014, 15:20

Ngày tải lên: 30/03/2014, 20:20