when indices won t do

... what about statements—the instructions? In fact, I’ve cheated I’ve introduced two types of statements already: the print statement, and assignments So, what’s the difference between a statement ... builder http://wxglade.sf.net ActivePython is a Python distribution from ActiveState (http://www.activestate.com) At its core, it’s the same as the standard Python distribution for Windows The main ... false When it is true, however, the following statement (in this case, a print statement) is executed Note also that when using if statements in the interactive interpreter, you have to press Enter...

Ngày tải lên: 26/10/2014, 20:10

... relaunches in a healthier incarnation, you hope) You could also, at this point, type sudo shutdown -h now to make your Mac, elsewhere on the network, shut down (Terminal doesn 't type any kind of ... conduct a full Unix Terminal session as described in Chapter 16—but by remote control Tip: For a more thorough description of SSH and its options, type man ssh at the prompt 22.4.2 Remote Control ... of the most common uses of SSH is quitting a stuck program Maybe it's a program that doesn 't respond to the usual Force Quit commands—;maybe even the Finder or Terminal Or maybe, having just arrived...

Ngày tải lên: 14/12/2013, 12:15

... nameString = ""; string wordString = ""; Read CONTENT_LENGTH int contentLength = 0; characters of POST data // content was submitted if ( getenv( "CONTENT_LENGTH" ) ) { contentLength = atoi( getenv( ... environmentVariables[ 24 ] = { "COMSPEC", "DOCUMENT_ROOT", "GATEWAY_INTERFACE", "HTTP_ACCEPT", "HTTP_ACCEPT_ENCODING", "HTTP_ACCEPT_LANGUAGE", "HTTP_CONNECTION", "HTTP_HOST", "HTTP_USER_AGENT", "PATH", ... push button submit A push button that submits form data according to the form’s action image The same as submit, but displays an image rather than a push button reset A push button that resets form...

Ngày tải lên: 24/03/2014, 20:21

... generated content This content is primarily stored in databases, which is used by an application or middle layer to format the data to HTML The web server then sends the content to the browser The ... In most cases, the actual content is static although the server application creates the page dynamically, the content itself is not input It is also not created dynamically by other methods, ... different directions and the food that it eats The Snake application will be developed further later in the chapter in the context of signed scripts You will see new features that allow you to run the...

Ngày tải lên: 21/01/2014, 06:20

... content to tell the web server what to pass when the script produces its output 12.4.2 Generating Content from a Database One of the important facets of dynamically generated content is interaction ... example, the CGI module is loaded with the Python import statement, and the form object is initialized so that data input to the page in the form of URL ?name=value pairs create the XUL content dynamically ... "Project." The SQL script creates a table called "sample" and then inserts value pairs into the table To use this type content generation, your database must be set up to handle table creation...

Ngày tải lên: 21/01/2014, 06:20

... certificates you've distributed It's best to state clearly on the web site hosting these signed remote Mozilla applications that the distribution certificate is needed If you distribute many different ... ASCII representation of the certificate 12.5.3.3 Creating a distribution CA certificate Next you must create a distribution certificate This certificate will be installed into the user's Mozilla ... Other to finish Is this a critical extension [y/n]? n Note the differences between this process and that used to create the root certificate The distribution certificate is not self-signed, so to...

Ngày tải lên: 21/01/2014, 06:20

... applications from other certificate authorities, they need to install a distribution certificate from that certificate authority Installing the certificate is easy Just provide the users with a regular ... globally In this example, the code hides the titlebar via the window object Security is extremely important, so it is important that some means of granting special privileges to trusted scripts for ... directories together Archive and sign the application SignTool takes care of both steps simultaneously, putting your application files in a JAR with a digital signature to validate everything The...

Ngày tải lên: 21/01/2014, 06:20

... As stated earlier, scores.js (containing the SOAP functions) must exist outside the JAR file It is loaded up into cache with this HTML document, and then the page redirects ... Mozilla SOAP doesn 't need to reference a WDSL file to make SOAP transactions Example 12-15 is a portion of the WDSL that NET generates and is the specific portion that relates directly to sending ... The most important thing to notice in this WSDL is the soapAction In Example 12-15, uri:SnakeScore/GetScore is defined as the identifier for the SnakeScore object's GetScore function This...

Ngày tải lên: 26/01/2014, 07:20

... formatting text HTML is basically a typesetting language that tells the computer what color to make the text, where to put text, how large to make the text, and what shape the text should be It’s ... httpd server This is the server that is setting the standard for the Net—if you can call a target moving at light speed a standard But I would rather try to stay with this fast-moving target than ... on TCP/IP, the Public Socket, and the Port On the Internet, the connection is made using TCP/IP TCP/IP stands for Transport Control Protocol/Internet Protocol That means that the method for transporting...

Ngày tải lên: 25/03/2014, 10:29

... trace (“total is ” +Person.total); // Outputs // total is // total is Getters and Setters Getters and setters are special methods to access private variables The getter is the method that retrieves ... is a tag that wraps every other tag That is used by the interpreter to start rendering the application If you are familiar with HTML you know that the root tag of each page is In ... (ActionScript 3), and implements a set of patterns to adopt in different situations There are a few reasons for this: • It is easier to develop • It favors the team to work consistently • It aggregates...

Ngày tải lên: 31/05/2014, 00:11

... all but one color with Iris Studio If the picture is too flat, shoot it and make it flatter with ToonPaint or push the saturation and blur with TiltShift If the picture is just boring, try randomizing ... image iterations Dozens of iterations Turning snapshots into statements With the right subject, shot and processed with just the right intent, you can transform your image into an illustration of ... drain the spontaneity out of the iPhone experience So don t think too much, because although it’s the simplicity and lightweight shooting that make mobile photos so intuitive it is the postprocessing...

Ngày tải lên: 31/05/2014, 01:14

... will continue in perpetuity It is a term that attempts to balance the often conflicting ideals of economic growth and maintaining environmental quality and viability There are three interacting ... writing this edited volume is that there are few books that bring together case studies, theory and applications of GIs and environmental modelling in one volume Even though we attempt to present the ... are sustainable is a non-trivial problem Possibly the advantage of the debate about sustainable development is that the long-term capacity of the earth to maintain human life through a healthy and...

Ngày tải lên: 12/08/2014, 02:22

... assumed that the three vegetation states are system equilibria Rietkerk et al (1996) show that according to the literature this is a reasonable assumption; the primeval vegetation of the Sahel at low ... correctly predicted by the expert system There was no statistically significant difference between the accuracy of the expert system map and the map prepared by the soil scientist, as tested by the ... intensities is a perennial grass steppe They go on to discuss the various transition phases between the three vegetation states and to support their conclusion that Figure 2.1 is reasonable they...

Ngày tải lên: 12/08/2014, 02:22

... geo-stationary satellite Meteosat is currently the primary satellite, with Meteosat as standby Meteosat is controlled by Eumetsat, an international organization representing 17 European states Meteosat ... once the exclusive domain of spy satellites In the 1960s, spy satellites existed that had a resolution better than 10 meters Civil satellites had to wait until the very last days of the 2oth century ... concentrations Assign proportions to constituents in mixed spatial elements Delineate spatial distribution of the constituents Monitor changes in constituents through periodic data acquisitions...

Ngày tải lên: 12/08/2014, 02:22

... not pertain to a specific species but refer to vegetation types or land units Use o f the term habitat is not restricted to habitat maps It has proliferated into the literature dealing with the ... space It is noteworthy that none of the cited articles related animal distribution to spatial pattern of rainfall prior to or during the study Instead, animal distribution tends to be related to ... and those indirectly detrimental to wildlife through impact on their habitat Among these, the alteration and loss of habitat is considered the greatest threat to the richness of life on Earth...

Ngày tải lên: 12/08/2014, 02:22

... soils exhibit an initial resistance to wetting (Selby 1982) During infiltration the soil is getting soaked, but when the rainfall stops soil beneath the wetting front is still getting wetter while ... important role in many processes related to how vegetation controls the movement of water from the roots, through the plant and from the plant to the atmosphere It is also important in determining ... partition precipitation into evaporation and input to the terrestrial ecosystem have been employed over the last centuries In the early nineteenth century, John Dalton formulated the law that...

Ngày tải lên: 12/08/2014, 02:23

... other hand, due to the low spatial resolution of the TM thermal data (120x120 m) the best night-time T M thermal data can not detect a coal fire less than 50 m even if they have high temDerature ... adequate knowledge about the extent of the damage shortly after the earthquake This requires both detailed digital information about the situation before the disaster occurs (for example, about population, ... developed countries These statistics illustrate well the importance of hazard mitigation The International Community has become aware of the necessity to increase the work on disaster management The decade...

Ngày tải lên: 12/08/2014, 02:23

... Chapter 3) The participants felt that remote sensing image interpretation is still a problem; this perhaps partly reflects the fact that the course Copyright 2002 Andrew Skidmore 256 Environmental ... spatial and temporal resolution of RS (4) Standardization of spatial data (2) Lower the cost of data (2) Global climate database Global data accessibility network Development of data infrastructures ... Chapter 3) The participants and lecturers expected high resolution imagery to be most useful for environmental modelling Most of the other solutions suggest improved methods to store and distribute...

Ngày tải lên: 12/08/2014, 02:23

... (5'-GAATCTCTCTGTTTTCTGCCAG) The second round reaction was with Pro3F (5'-AGANCAGAGCCAACAGCCCCACCA and ProRT (5'-TTTCCCCACTAACTTCTGTATGTCATTGACA) The cycling conditions were the same except that the annealing ... using MSF12b (5'-AAATCTCTAGCAGTGGCGCCCGAACAG) and OFMR1 (5'-TGAGGGATCTCTAGTTACCAGAGTC), followed by F2nst (5'GCGGAGGCTAGAAGGAGAGAGATGG) and ofm19 (5'-GCACTCAAGGCAAGCTTTATTGAGGCTTA) PCR was performed ... there were at least 13 different subtypes, sub-subtypes or CRF represented It is hypothesized that that this diversity may be due to remnants of the viruses predating the epidemic in 1960 Methods...

Ngày tải lên: 12/08/2014, 23:23

... our Caption Editing System (CES) to integrate it with Microsoft PowerPoint, creating our new Caption Editing System with PresentationIntegration (CESPI) The architecture in terms of code interface ... showed that CESPI provided a 37.6% improvement in total editing time 4. Results Fig 10 Figure shows that out of the improvement of editing time shown in Table 2, 50.3% accounted for Content Layout ... extension  to  IBM  Caption  Editing  System  (hereafter  CES).  CESPI  completely includes all the functions within CES, but  is  further  extended  to  include  the  presentation  integration functions...

Ngày tải lên: 10/11/2014, 20:59