... (interrogative sentence) , command (or imperative sentence) , and exclamation (or exclamatory sentence) 1.3.1 A Statement/ A Declarative sentence A Statement or a declarative sentence is a sentence that ... effective approaches that learners not really seem to notice is the comparative analysis between foreign languages and native language This will help learners acquire foreign languages easily In ... an Imperative sentence: A command/ an imperative sentence is a sentence that gives a command or makes a request Commands have no overt grammatical subject, and whose verb is in the imperative E.g.:...
Ngày tải lên: 02/03/2015, 14:30
... on a computer in M A C L I S P and have applied them to all of the artificial languages in Angluin's paper as well as to all of the natural language examples in this paper THE ENGLISH SYSTEM AUXILIARY ... M a ~ and John must have all tails in common In particular, the third string shows that Mary has eats pies as a tail, so John must also have eats pies as a tail Our current hypothesis after having ... externally handled and the infrequent The auxiliary system has often been regarded ,as an acid test for a theory of langulage acquisition Given this, we are encouraged that it is in fact learnable...
Ngày tải lên: 24/03/2014, 01:21
THE USES AND FORMATION OF THE ENGLISH VERB TENSES
... Form past participle past participle past participle past participle Simple Past Past Continuous Past Perfect Past Perfect Continuous was/were was/were being had been had been being past participle ... were being had been had been being past participle past participle past participle past participle * In the Simple Present and Simple Past tenses of the Active Voice, the auxiliaries are used only ... for many irregular verbs, the Simple Past has the same form as the past participle **** The other modal auxiliaries could, may, might, must, should and would form conjugations in the same way as...
Ngày tải lên: 02/07/2014, 21:00
Evaluating the Reliability and Validity of an English Achievement Test for Third-year Non- major students at the University of Technology, Ho Chi Minh National University and some suggestions for chan
... mastery of what has been learnt, what has been taught or what is in the syllabus, textbook, materials, etc An achievement test therefore is an instrument designed to measure what a person has ... of particular content areas and group characteristics such as: sex, race, and ethnic background It is also systematic Random factors: are unsystematic factors including unpredictable and largely ... We can infer from the figure that a score in a language test is indicated by communicative language ability Also, the language test is affected by factors other than communicative language ability...
Ngày tải lên: 07/11/2012, 15:05
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.
... or adapt another language as their second language All the language (native and foreign languages), always convey cultural characteristics It is the basic cultural factor that distinguishes this ... conditional breakfast They often have cereal or porridge, egg and bacon followed by toast and marmalade and coffee and tea or they may just have a toast and marmalade and coffee and tea *Elevenses ... action is highly appreciated is that males seat and rise when females leave and return to the table Actually, knowing how to use table ware and understand and what should be avoided is a way to...
Ngày tải lên: 15/04/2013, 15:11
A study of the english translational versions of tring cong son's songs in terms of semantic and syntactic features
... Translation by using a loan word or loan word plus explanation - Translation by paraphrase using a related word - Translation by paraphrase using unrelated word - Translation by omission - Translate ... of translation: - Word-for-word translation - Literal translation - Faithful translation - Semantic translation - Adaptation - Free translation - Idiomatic translation - Communicative translation ... same ways as the audience in SL does However, to translate a language into another language effectively and transfer the specific messages into the target is always a very difficult task Especially,...
Ngày tải lên: 26/11/2013, 13:23
A Brief History of the English Language and Literature, Vol. 2 doc
... the greatest minuteness:-AFRICAN DIALECTS Baobab Canary Chimpanzee Gnu Gorilla Guinea Karoo Kraal Oasis Quagga Zebra AMERICAN TONGUES Alpaca Buccaneer Cacique Cannibal Canoe Caoutchouc Cayman Chocolate ... Influenza Lagoon Lava Lazaretto Macaroni Madonna Madrigal Malaria Manifesto CHAPTER V 39 Motto Moustache Niche Opera Oratorio Palette Pantaloon Parapet Pedant Pianoforte Piazza Pistol Portico Proviso ... list:-Alarm Alert Alto Arcade Balcony Balustrade Bandit Bankrupt Bravo Brigade Brigand Broccoli Burlesque Bust Cameo Canteen Canto Caprice Caricature Carnival Cartoon Cascade Cavalcade Charlatan...
Ngày tải lên: 17/03/2014, 02:20
PROJECT TITLE: “UNDERSTANDING THE STATEMENT OF PRODUCTION AND BUSINESS OF THE THANG LONG INFORMATICS JOIN STOCK COMPANY” ppt
... more is effective As assets increase, profit also increased 4.2 Analysis of the profitability of assets Similar to the above analysis, the criteria can be studied separately for each type of activity ... engineers are experienced and trained at home and abroad, now iThangLong is on the way to become a software manufacturer has extended the product range, and supply the integrated package for customers ... FACULTY OF ACCOUNTING AND BUSINESS ADMINISTRATION - 12 INTERNSHIP REPORT Vu Thi Hai Yen – Vu Thi Chuyen From the chart above, we see that all staffs are in labor age They have health and capacity...
Ngày tải lên: 22/03/2014, 11:20
Báo cáo sinh học: " Imperfect DNA mirror repeats in the gag gene of HIV-1 (HXB2) identify key functional domains and coincide with protein structural elements in each of the mature proteins" doc
... end ca ac tc ct gg gg at ta tc ct ct tc ca ac aa aa gg gg at ta ag ga tt tt ct tc tg gt ta at tt tt ag ga ag ga cc cc tt tt ct tc ca ac ca ac cc cc ca ac tt tt ag ga gg gg ta at at ta ag ga gt ... gg ta at at ta ag ga gt tg gc cg ca ac at ta gg gg aa aa aa aa ag ga tt tt gg gg aa aa at ta gg gg gg gg at ta ag ga ct tc tt tt aa aa cc cc rd-IMRs nt prot AA 1261 803 108 1279 300 200 97 1408 ... Gag and Gag-Pol are differentially cleaved at maturation Gag Gag-Pol stage stage MA-CA-p2\1/NC-p1-p6 MA-CA-p2\1/NC-GagTF-pol Gag Gag-Pol stage stage MA\2/CA-p2\1/NC-p1\2/p6 MA\2/CA-p2\1/NC\2/GagTF-Pol...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo lâm nghiệp: "Spatio-temporal patterns of the Norway spruce decline in the Beskid Śląski and Żywiecki (Western Carpathians) in southern Poland" pot
... situation turned to catastrophic state, with a real risk of a total forest decline on large areas This paper is aimed to present the spatio-temporal characteristics of this process during last ... Jeleśnia, Ujsoły, Ustroń, Węgierska Górka and Wis a for kindly providing the data and map used for the analyses presented in this paper, and Dr Marcin Jachym for the basic digital map used for data ... A. , 1989 Gradacja wskaźnicy modrzewianeczki Zeiraphera griseana Hb (Lepidoptera, Tortricidae) w Polsce w latach 1977–1983 Prace Instytutu Badawczego Leśnictwa, 689: 95–152 CHRISTIANSEN E., WARING...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo y học: " An association between the acute phase response and patterns of antigen induced T cell proliferation in juvenile idiopathic arthritis" ppt
... Arthritis Research & Therapy Vol No Black et al Table Clinical features of patients with juvenile idiopathic arthritis Subclass n Oligoarthritis Age in years Female/male (median [range]) ... acute phase was low and a diverse pattern when the acute phase was high Patient B exhibited a diverse pattern when the acute phase was high and this was lost when the acute phase was low Similarly, ... patients displayed this pattern of response (Fig 1) PH A O ox Te tT ys pL on el re St Sa lm sin ia EL ro (b) 25000 PBMC SFMC 20000 CPM Statistical analyses Mann–Whitney and Rank Spearman’s analyses...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot
... especially against subtype C isolates in this assay A low IC50 against SF162 was also observed in the PBMC-based assay [IC50>50 μg/ ml] (Table 2) The reason that MAb C2EB5 was able to neutralize ... Decker JM, Wang S, Hui H, Kappes JC, Wu X, SalazarGonzalez JF, Salazar MG, Kilby JM, Saag MS, Komarova NL, Nowak MA, Hahn BH, Kwong PD, Shaw GM: Antibody neutralization and escape by HIV-1 Nature 2003, ... regions are an alternative way to develop an effective vaccine against HIV Accordingly, these data may facilitate our understanding of essential characteristics to design an immunogen to induce broadly...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " The establishment and characterization of the first canine hepatocellular carcinoma cell line, which resembles human oncogenic expression patterns" ppsx
... GGCTGGGGTGTTGAAGGTCTC TGTGCTGTGAAATCCCTGAATAGAATC CCAAGAGTGAGAGTACGTTTGGATGAC AGATGTTAGTGACAATGAACCT GTGATTTGTGTGTGCTGATC CGGAGGGACGCCAAACAGG GTCCCGGGTCAACTCTTCGTG TGGAGAGCGTCAACCGGGAGATGT AGGTGTGCAGATGCCGGTTCAGGT ... canine c-MET.seq c-MET human.seq GGCACCCTAGAGCTGAACTGCGCCCATCTTTTTCTGAACTGGTCTCCAGGATATCAGCAA GGCACCCTAGAGCTGAACTGCGCCCATCTTTTTCTGAACTGGTCTCCAGGATATCAGCAA GGCACCCTAAAGCCGAAATGCGCCCATCCTTTTCTGAACTGGTGTCCCGGATATCAGCGA ... AGGTGTGCAGATGCCGGTTCAGGT ATGGGTAGGGCAAATCAGTAAGAGGT AAGCATCGTATCACAGCAGGTTAC CCGCCTTGGTGGTGGTCTCC AGGGCGCTGGGCTTCTCGT ACACCAGCCTGCGCCTCAAGACCT CGCCTCGCCGCCCGTCA GTGTGTACAGAACGGCCTCA TCGCAAATCACGTCATCG GTGGGCGATTGGATGCTCTTTG...
Ngày tải lên: 13/08/2014, 13:20
Ahn and cheung the intraday patterns of the spread and depth in a market without market makers
... that the intraday U-shaped spread and the reverse U-shaped depth patterns are not solely attributable to specialists’ market-making behavior, as many microstructure studies assume Specialist participation ... dealers in the National Association of Securities Dealers Automated Quotation system ŽNasdaq or specialists in the New York Stock Exchange ŽNYSE and the American Stock Exchange ŽAmex assume a ... document a similar U-shaped intraday pattern of the NYSE spread In particular, Chung et al Ž1999 suggest that the U-shaped intraday spread pattern on the NYSE is attributable to the trading behavior...
Ngày tải lên: 31/10/2014, 10:17
a study on meanings of the english preposition in and its vietnamese equivalents from a cognitive semantic perspective = nghiên cứu các nghĩa của giới từ in trong tiếng anh và các nghĩa tương đương
... conventionalized to designate temporal expressions concerning a certain part of a day, a season in a year, a particular month in a year, a particular year in which a significant event or a habitual activity ... representative and extended from human capacities of imagination (such as metaphorical mappings and image schema transformation) demonstrating a natural and systematic organization of related senses ... Polysemy is accounted for within a general approach to human categorization that rejects the idea that human reasoning is solely based on the capacity to manipulate abstract symbols Rather, human reasoning...
Ngày tải lên: 02/03/2015, 14:22
a study on the meaning and structure of an english fairy-tale a systemic functional analysis = nghiên cứu về ngữ nghĩa và cấu trúc của một câu truyện cổ tiếng anh theo quan điểm của ngữ pháp chức năng hệ thống
... functional grammar Systemic functional grammar is a grammatical model developed by M .A. K Halliday In his book An introduction to Functional Grammar (1994), Halliday explained that his grammar is called ... the grammar of a language One approach sees grammar as a set of rules which specify all the possible grammatical structures of the language where grammatical and ungrammatical sentences are distinguished ... real world sources Another approach sees language as a system of communication and analyses grammar to discover by what means it allows speakers and writers to make and exchange meanings Its main...
Ngày tải lên: 02/03/2015, 14:22
A research on the advantages and disadvantages of the application of task-based approach in teaching speaking to the fisrt-year non -English major students at H
... in language teaching 1.2.1 What is speaking skill? 1.2.2 The importance of speaking skill in language teaching programs .8 1.3 Factors affecting TBLT application in speaking ... 12 2.1.1 English language teaching at HaUI 12 2.1.2 The teaching materials and assessment 13 2.1.3 Teachers and students 13 2.1.4 Teaching and learning facilities ... Task-based language teaching 1.1.1 What is a task? .4 1.1.2 Task types 1.1.3 What is TBLT? 1.1.4 A framework for designing TB lessons .6 1.2 Speaking...
Ngày tải lên: 28/03/2015, 08:56
A research on the advantages and disadvantages of the application of task-based approach in teaching speaking to the fisrt-year non-English major students at Ha
... there also exist some disadvantages Being a teacher of Faculty of Foreign Languages at HaUI, I find that it is necessary to make clear these advantages and disadvantages to sort out the disadvantages ... Strongly agree b)Agree c) Neutral d)Disagree e) Strongly disagree V Your advantages and disadvantages in learning English speaking with a task-based approach and possible suggestions 1 .What advantages ... the disadvantages and to exploit the advantages in implementing this approach Aims of the study The study is aimed at finding out the advantages and disadvantages of using a taskbased approach...
Ngày tải lên: 28/03/2015, 08:56