webinars q amp a and youtube videos

the effectiveness of using youtube videos as supplementary materials on enhancing students listening skills a study conducted at international standard program university of languages and internat pdf

the effectiveness of using youtube videos as supplementary materials on enhancing students listening skills a study conducted at international standard program university of languages and internat pdf

Ngày tải lên : 25/12/2015, 17:23
... visual materials, in particular videos, are obligatory for effective language learning and teaching, educators have approached YouTube as a vast source of materials (Britisch, 2009; War-schauer ... contain only ideally and unrealistically acceptable examples Authentic materials also give the learners the opportunity to gain real information and know what is actually going on in the world around ... so that they can be used each year Another approach is to choose a material that is appealing and attractive to the students and return to it several times during the year For example, if teachers...
  • 147
  • 874
  • 6
Business and Economics Q Manual A student guide for producing quality work on time ppt

Business and Economics Q Manual A student guide for producing quality work on time ppt

Ngày tải lên : 02/04/2014, 05:21
... world: Latin America and Carribean (R 1), South Asia (R 2) and Sub-Saharian Africa (R 3) The analysis indicates that the infectious disease situation in Sub-Saharian Africa is much worse than that ... stress? What are the advantages and W disadvantages of these strategies? n  hat can individuals to reduce stress? What are the advantages and disadvantages of W these strategies? 19 Calculation questions ... particular information you need might be available in the library databases A wide range of academic-quality documents (especially journal articles) and data (e.g detailed company financial data,...
  • 116
  • 417
  • 0
Báo cáo hóa học: " Research Article A New Approach to q-Bernoulli Numbers and q-Bernoulli Polynomials Related to q-Bernstein Polynomials" pdf

Báo cáo hóa học: " Research Article A New Approach to q-Bernoulli Numbers and q-Bernoulli Polynomials Related to q-Bernstein Polynomials" pdf

Ngày tải lên : 21/06/2014, 07:20
... numbers attached to χ are as follows, ∞ −t Dq,χ t, x χ d qd e d q t d 2.19 ∞ tn Bn,χ ,q n! n By 2.1 and 2.18 , one sees that s−1 Dq,χ t, x qa χ a Dqs t s q , x a s a 2.20 ∞ s n q n s−1 qa χ a Bn,qs ... x; q Bv,χ ,q x log q One now defines particular q- zeta function as follows, qm m s q 2.32 qa ∗ a , s ζqF s, F F q 2.33 Hq s, a | F m a mod F From 2.32 , one has Hq s, a | F ∗ where ζqF s, a/ F ... special case x called the nth q- Bernoulli numbers That is, Dq t −t Dq t, ∞ qy e y ∞ t Bn ,q y n 0, Bn ,q tn n! Bn ,q are 2.3 From 2.1 and 2.3 , we note that qDq t, − Dq t qet Dq qt − Dq t ∞ q l ∞...
  • 9
  • 442
  • 0
Báo cáo sinh học: "Research Article A Note on Symmetric Properties of the Twisted q-Bernoulli Polynomials and the Twisted Generalized q-Bernoulli Polynomials" docx

Báo cáo sinh học: "Research Article A Note on Symmetric Properties of the Twisted q-Bernoulli Polynomials and the Twisted Generalized q-Bernoulli Polynomials" docx

Ngày tải lên : 21/06/2014, 16:20
... generalized Bernoulli numbers Bn,χ,w and polynomials Bn,χ,w x attached to χ as follows: t t ∞ d−1 a a at aa w q e wd qd edt − log q log q d−1 a 0χ d qd edt w q Bn,χ,w n ∞ a wa qa eat ext q tn ... Bn,χ,w and polynomials Bn,χ,w x attached to χ of order k are defined as log q ∞ log q k ,q Bn,χ,w n k d−1 a a at aa w q e d qd edt − w t k d−1 a a at aa w q e wd qd edt − t ∞ ext tn , n! k ,q ... numbers and polynomials associated with p-adic q- integral on Zp at q −1,” Journal of Mathematical Analysis and Applications, vol 331, no 2, pp 779–792, 2007 14 T Kim, A note on p-adic q- integral...
  • 13
  • 357
  • 0
Báo cáo hóa học: " Research Article A Note on the q-Genocchi Numbers and Polynomials" pdf

Báo cáo hóa học: " Research Article A Note on the q-Genocchi Numbers and Polynomials" pdf

Ngày tải lên : 22/06/2014, 18:20
... q- integral on Z p ,” to appear in Applied Mathematics Letters [12] H M Srivastava, T Kim, and Y Simsek, q- Bernoulli numbers and polynomials associated with multiple q- zeta functions and basic L-series,” ... [2 ]q t (−1)k e[k+x ]q t = [2 ]q t (−1 )a (−1)k e[k+ (a+ x)/m]qm [m ]q t n! a= 0 k =0 k =0 = [2 ]q [m ]q [2]qm ∞ = n =0 ∞ = n =0 m−1 ∞ (−1 )a [m ]q t[2]qm a= 0 [2 ]q [m ]q [2]qm (−1)k e[m ]q t[k+ (a+ x)/m]qm k ... a= 0 (−1 )a [m]n Gn,qm q x +a m m−1 [2 ]q x +a [m]n−1 (−1 )a Gn,qm q m [2 ]q m a= 0 Therefore, we obtain the following theorem tn n! tn , n! where m ∈ N odd (2.12) Journal of Inequalities and Applications...
  • 8
  • 322
  • 0
Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt

Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt

Ngày tải lên : 08/08/2014, 18:21
... colour measurements G Roy and JL Giraud at Tonnellerie Taransaud were invaluable in acquiring French oak samples and Pr V Vereshchagina and her colleagues at the University of Perm and at Voronezh ... mature trees, additional samples were used to confirm the variation of soluble ellagitannins with heartwood age MATERIALS AND METHODS Materials Variation within trees A core was taken with a ... However, analyses of variance found that only b* and the derived variables hue and colour saturation varied significantly between the two forests, while significant variation between trees and samples...
  • 14
  • 384
  • 0
Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc

Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc

Ngày tải lên : 08/08/2014, 19:21
... example, a ψ wp of about -3 MPa was accompanied by a D for ≈ 0.26 in Q cerris and Q petraea, but of ≈ 0.30 in Q rubra Osmotic leaf water potential potential at full turgor (π and ... probably play a major role and differ significantly among species (Abrams, 1990; Cochard et al, 1992; Bréda et al, 1993) In addition, the ability to maintain significant rates of CO assimilation and ... oversaturation of the leaf disks Drought effects on stomatal conductance and net CO assimilation rate Stomatal conductance to water vapor (ψ ) w and net CO assimilation rates (A) dis2 played...
  • 13
  • 402
  • 0
Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps

Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps

Ngày tải lên : 08/08/2014, 19:21
... (1983) An analysis of variation of traea leaf characters in Quercus robur L and Q petraea (Matt) Liebl population samples from Northern Ireland Iri For 40, 52-77 Tutin TG, Heywood VH, Burges NA, Valentine ... (Matt) Liebl Watsonia 11, 229-236 Rushton BS (1978) Quercus robur L and Q pe(Matt) Liebl: a multivariate approach to the hybrid problem Data acquisition analysis and interpretation Watsonia 12, 81-101 ... hybrids How abundantly hybrids occur in different regions was of minor imwas portance MATERIALS AND METHODS (for details see Aas, 1988) Oaks chosen from 30 different stands in and Poland (stands of...
  • 7
  • 287
  • 0
Báo cáo y học: " A questionnaire for determining prevalence of diabetes related foot disease (Q-DFD): construction and validation" potx

Báo cáo y học: " A questionnaire for determining prevalence of diabetes related foot disease (Q-DFD): construction and validation" potx

Ngày tải lên : 10/08/2014, 21:24
... the plantar aspect of the 1st and 5th metatarsophalangeal joints) and assessment for vasculopathy by determining bilateral Ankle Brachial Indices (using an mHz hand held Doppler, standard blood ... Prevalence rates for Samples B and C were calculated as absolute frequencies and are reported as overall percentages Agreement between survey results and clinical assessment for Sample B and ... cuff and sphygmomanometer) and manual palpation of pedal pulses The presence of foot deformity or pressure areas was recorded, as was history of amputation and past and present history of ulceration...
  • 10
  • 458
  • 0
THE EFFECTIVENESS OF USING YOUTUBE VIDEOS AS SUPPLEMENTARY MATERIALS ON ENHANCING STUDENTS LISTENING SKILLS a STUDY AT INTERNATIONAL STANDARD PROGRAM

THE EFFECTIVENESS OF USING YOUTUBE VIDEOS AS SUPPLEMENTARY MATERIALS ON ENHANCING STUDENTS LISTENING SKILLS a STUDY AT INTERNATIONAL STANDARD PROGRAM

Ngày tải lên : 14/09/2015, 09:28
... visual materials, in particular videos, are obligatory for effective language learning and teaching, educators have approached YouTube as a vast source of materials (Britisch, 2009; War-schauer ... contain only ideally and unrealistically acceptable examples Authentic materials also give the learners the opportunity to gain real information and know what is actually going on in the world around ... so that they can be used each year Another approach is to choose a material that is appealing and attractive to the students and return to it several times during the year For example, if teachers...
  • 145
  • 558
  • 0
600 sentences of certificate A and B

600 sentences of certificate A and B

Ngày tải lên : 05/11/2012, 09:18
... desk a the b a c an d some > c 134 What is color of your pen? a the b a c an d any > a 135 Kate and Mary are going to cinema a the b a c an d no article > a 136 My parents are always at ... countries a Sun b always c on d in > a 52 The man that wife and family are away seems very lonely a that b and c are d seems > a 53 Each year more and more people try setting new and unusual records ... has been demand for computers this year than last year a few b little c fewer d more > d 290 Always make sure your luggage has on it when you travel a a card b a cartel c a label d a traveling-bag...
  • 280
  • 884
  • 3
Test yourself A and Test 1(Kiều Tính)

Test yourself A and Test 1(Kiều Tính)

Ngày tải lên : 02/07/2013, 01:25
... climbing, backpacking, and adventure tourism Some recreational activities are made illegal such as gambling and drug use Research has shown that recreation contributes to life satisfaction, quality ... life, health and wellness, and that the use of recreation as a diversion may have clinical applications to individuals with chronic pain and other health impairments In some cultures and religions, ... Holiday is also a common time for recreation Traditionally, music and dance serve as recreation in many cultures Playing sports, hobbies, games and tourism are popular forms of recreation Watching...
  • 5
  • 719
  • 1
Tài liệu Đề tài " Boundary regularity for the Monge-Amp`ere and affine maximal surface equations " docx

Tài liệu Đề tài " Boundary regularity for the Monge-Amp`ere and affine maximal surface equations " docx

Ngày tải lên : 16/02/2014, 06:20
... Annals of Mathematics, 167 (2008), 993–1028 Boundary regularity for the Monge -Amp` re e and a ne maximal surface equations By Neil S Trudinger and Xu-Jia Wang* Abstract In this paper, we ... o approach, we also establish the existence and uniqueness of globally smooth solutions to the second boundary value problem for the a ne maximal surface equation and a ne mean curvature equation ... the application of our 996 NEIL S TRUDINGER AND XU-JIA WANG preceding arguments to the a ne maximal surface and a ne mean curvature equations, (1.4) In these cases, the global second derivative...
  • 38
  • 330
  • 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Ngày tải lên : 18/02/2014, 04:20
... TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; ... 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: ... AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining for NF-jBp65 MSCs in IMDM supplemented with 10% fetal...
  • 11
  • 653
  • 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Ngày tải lên : 18/02/2014, 08:20
... FEBS G Vaaje-Kolstad et al L lactis chitinase and chitin-binding protein A B Fig Sequence alignments for LlChi1 8A and LlCBP3 3A (A) Catalytic domains of LlChi1 8A (chitinase of L lactis ssp lactis), ... containing a putative transcription regulator (GenBank ID: AAK06047.1), chitinase gene (GenBank ID: AAK06048.1) and gene encoding a family 33 CBP (GenBank ID: AAK06049.1) was amplied FEBS Journal ... initial phase was maintained longer than in the absence of LlCBP3 3A, indicating that LlCBP3 3A acts synergistically with LlChi1 8A However, the effect of LlCBP3 3A was small and ceased after approximately...
  • 14
  • 683
  • 0
Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf

Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf

Ngày tải lên : 19/02/2014, 12:20
... b1,3galactosidases, giving rise to a disaccharide and a monosaccharide, and was thus identified as a mixture of Galb1-4[Fuca1-3]GlcNAcb1-3Gal and Galb1-3[Fuca1-4]GlcNAcb1-3Gal The calculated amounts ... b1,4galactosidases, giving rise to a disaccharide and a monosaccharide, and is thus identified as a mixture of Galb1-3GlcNAcb1-3Gal and Galb1-4GlcNAcb1-3Gal The tetrasaccharide is sensitive to a1 ,3/4 ... fucosidase giving rise to a trisaccharide that provides equal amounts of radioactive disaccharide and monosaccharide upon b1,3galactosidase treatment, and is thus identified as Galb1-3[Fuca1-4]GlcNAcb1-3Gal...
  • 9
  • 460
  • 0
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

Ngày tải lên : 06/03/2014, 09:22
... synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢ ... 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP ... quantification was performed by nonsaturating picture scanning by a gel Doc 1000 Molecular Analyst apparatus (Biorad) Respiratory parameters and respiratory ratio in intact cells Respiratory parameters and...
  • 13
  • 503
  • 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Ngày tải lên : 06/03/2014, 22:21
... understanding of its pathogenic mechanisms an urgent challenge [9,10] S aureus produces a variety of cell surface-associated and extracellular factors that enable bacteria to colonize and multiply ... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... FnBPA Finally, we selected and characterized a mAb produced against the recombinant repetitive region of FnBPB that recognizes an epitope shared by repeats of FnBPA and FnBPB, and inhibits staphylococcal...
  • 16
  • 560
  • 0