we begin with a lower bound eqalignno m

... For appropriate positive constants c1 and c2 , f (P ) is the objective function for our maximization problem In practice, we make c1 relatively large and c2 relatively small so that the f1 term ... prefer partitions having one large set The idea was to find a partition with a set large enough to improve the lower bound for R4 (3) However, the largest set found in any sumfree partition had 44 ... Problem of Schur and its Generalizations Acta Arithmetica, 20 (1972), 175-187 [2] H L Abbott and L Moser Sum-free Sets of Integers Acta Arithmetica, 11 (1966), 392-396 [3] F R K Chung On the Ramsey...

Ngày tải lên: 07/08/2014, 06:20

... Theory with Applications (Macmillan, New York, 1976) [2] Y Shi, On maximum cycle-distributed graphs, Discrete Math 71(1988) 57-71 [3] Chunhui Lai, On the Erd¨s problem, J Zhangzhou Teachers College(Natural ... Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R Murty, Graph Theory ... graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou Teachers College (Natural...

Ngày tải lên: 07/08/2014, 06:22

... becomes a1 a2 · · · an ≥ √ n n a1 a2 · · · an /an−i an−i /ai 2i/n , 2.26 Journal of Inequalities and Applications with equality for ··· a2 a1 In the case i , an−i ··· an−i an , 2.27 an−i an−i ... from 2.26 , we get a1 a2 · · · an ≥ √ n n a1 a2 · · · an a1 /an 2/n an /a1 , 2.28 with equality for a2 a3 Applying Theorem 2.1 for f x ··· an a1 an−1 2.29 1/x, we obtain the following Corollary ... Journal of Inequalities and Applications Equality in 2.18 holds for a1 a2 · · · an If i √ ak , ak ak a1 a2 · · · , · · · ak−1 Remark 2.9 For p1 a1 a2 ··· p2 pn with equality if and only if a1 ...

Ngày tải lên: 21/06/2014, 07:20

... the discharging process The difference between our claims and our structural lemmas is that the claims are statements about our discharging rules, whereas the lemmas are statements about any 1-ID ... from C1 and each receive no charge from C Thus, again C gives away total charge at most 52/29 We just proved that every open 3-cluster C gives away charge at most 52/29 Now Lemma states that ... Hence we may assume that 13 ∈ D and 35 ∈ D; by symmetry, we may also assume that 30 ∈ D and 45 ∈ D (see Fig 6) Observe that we have eight candidates to be nearby threatened clusters; these are...

Ngày tải lên: 08/08/2014, 01:20

... Ω (m2 /3 n2/3 + m + n) By applying a rotation, if necessary, we may assume that no line in L is vertical Therefore, without loss of generality we may assume that all lines of L have different non-infinite ... scaling the whole configuration, we may assume that the x-coordinates of all points of P are properly between and Then, the gradient of the ith parabola is at x = and + 2ε at x = Let ε be so small ... so small that the intervals [ai , + 2ε] are all disjoint: Namely, the gradient of the ith parabola at x = is smaller than the gradient of the (i + 1)st parabola at x = (or more specifically it is...

Ngày tải lên: 08/08/2014, 11:20

... cubic graph of order n, drawn uniformly at random, a dominating set of size at most 0.27942n asymptotically almost surely L¨wenstein and Rautenbach [11] showed that if we relax the minimum degree ... [8] K Kawarabayashi, M D Plummer, and A Saito, Domination in a graph with a 2-factor J Graph Theory 52 (2006), 1–6 [9] A V Kostochka and B Y Stodolsky, On domination in connected cubic graphs Discrete ... and D Rautenbach, Domination in graphs with minimum degree at o least two and large girth Graphs Combin 24 (2008), 37–46 [12] W McCuaig and B Shepherd, Domination in graphs with minimum degree...

Ngày tải lên: 08/08/2014, 12:23

... Iwamoto T, Coutant C, Ibrahim NK, Valero V, Cristofanilli M, Green MC, Radvanyi L, Hatzis C, Hortobagyi GN, Andre F, Gianni L, Symmans WF, Pusztai L: Molecular anatomy of breast cancer stroma and ... breast carcinomas distinguish tumor subclasses with clinical implications Proc Natl Acad Sci USA 2001, 98:10869-10874 Weigelt B, Mackay A, A Hern R, Natrajan R, Tan DS, Dowsett M, Ashworth A, ... that have no or limited generalizability This means that they fail to validate when applied to independent data or may demonstrate only nominally significant predictive value (that is, they may...

Ngày tải lên: 11/08/2014, 12:21

... CCTTCGGTTGGTGTTACT 19063-19080 AGCCTCAAGTTGGAGAAGA 18909-18927 522 3L GCAAAAGCTGATATGACAG 19412-19430 4U CATTGGCTTCAGGGATAAC 19288-19306 4L TGGCGTGTACTTGTAAAC 19748-19765 5U GGCAACAATCTGGCTATG 19661-19678 ... GAGGTTGATGCTGGTGAA 20136-20153 6U TGGAAATGACCTCAGAAC 20089-20106 515 6L 7U GAACCAGGAACCAGTCTT GTGGATGGGGAAGGATAC 20586-20603 20543-20560 506 7L TAAAGCAGGGTGGGCTCA 21031-21048 8U CATACCGTTCTCCAGCAACT ... 11 RNA respiratory viruses include influenza A and B virus, human respiratory syncytial virus A and B, human metapneumovirus, human parainfluenzavirus [1,9,17], human rhinovirus A, and human coronavirus...

Ngày tải lên: 11/08/2014, 21:21

... elements and mathematical optimization such as linear programming (LP) (Sloan 1988; Sloan and Kleeman 1995), and nonlinear programming (Lyamin and Sloan 200 2a, b), or SOCP (Makrodimopoulos and Martin ... few years ago In Chapter 2, the lower bound limit analysis both for plane strain and axisymmetric cases are formulated as a standard form of primal and dual SOCP problems It can be seen that SOCP ... encompasses several important classes of nonlinear optimization as special cases including minimization of a sum of norms, convex quadratic programming, and convex quadratically constrained linear...

Ngày tải lên: 10/09/2015, 09:05

... taking some away The forehead may be flattened, cut down, or built up as the case may be The cranium may be elongated, widened, or narrowed The facial plane may also be altered as we see fit without ... combine the ball with other basic forms With “solid forms” to build on, the head begins to take on more reality You can almost anything you want to with the supplementary forms, and come out all ... DIVIDED BALL AND PLANE METHOD 39 THE DIVIDED BALL AND PLANE METHOD What I wanted was a method whereby, if a head looked wrong, I could find out what was wrong with it, Tampering with a painted head...

Ngày tải lên: 13/09/2012, 14:19

Ngày tải lên: 04/10/2012, 10:25

... Federation notation), as well as with the presence of an impacted supernumerary tooth (distomolar 4.9) The patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without ... hyperdontia or dentes supernumerarii Ann Anat 2006;188:163-169 25 Batra P, Duggal R, Parkash H Non-syndromic multiple supernumerary teeth transmitted as an autosomal dominant trait J Oral Pathol Med ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic...

Ngày tải lên: 25/10/2012, 11:40

... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... t-test was performed for comparison of mean scores between groups One-way analysis of variance was used for comparison of means among groups Initially, categories with or without Sarapin in each ... Demographic characteristics Gender Male Female Age Mean ± SD Height (inch- Mean ± SD es) Weight Mean ± (pounds) SD Duration of Mean ± pain (months) SD Mode of onset Gradual of pain Sudden WC/MVA...

Ngày tải lên: 26/10/2012, 09:07

... content assessed immunocytochemically revealed that Vgf immunoreactive material in spinal cord motorneurons is already decreased in ~75 day old asymptomatic SOD-1 G9 3A- SOD1 ALS mice and continue ... spinal cord motorneurons in ALS SOD-1 ALS mice could mechanistically promote neurodegeneration by unleashing NMDA and AMPA excitotoxic injury Thus a mechanism by which abnormal energy metabolism ... homogenized in cell lysis buffer (20 mM Tris/HCl, pH 7.5, 150 mM NaCl, mM EDTA, mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, mM β-glycerophosphate, mM Na3VO4, μg/ml leupeptin, and 1mM...

Ngày tải lên: 03/11/2012, 10:52

... be a poet and not know what one was? It sounds like a confession I know: Hello my name is Mark and I 'm an alcoholic Hello my name is Mark and I 'm a drug addict Hello my name is Mark and I 'm guilty ... go to my Smashwords page marklewisauthor.com Mark Lewis on Facebook Myspace music page CONTACT: mark.lewis.writer@gmail.com CONFESSION Hello, my name is Mark and I 'm a poet Before you ask, yes, ... don't have a hover car I've never seen robot slaves or a titanium bra I don't have a time machine or a personal dinosaur farm I don't have my meals in a tablet or a bionic arm It's not that we need...

Ngày tải lên: 14/11/2012, 16:50

... header EMC Security Mission End-to-End Information Security Management EMC ISM Applications Vulnerability Management Threat Management Secure Content ID and Access Management Systems Information ... Storage Web Firewall Authentication Filtering Antivirus Encryption Change/Patch Management Vault Recovery Management Tape Spyware Go to View/Master/Slide Master to type in header Today’s Approach: ... SEC 1 7a- 4, NASD 3010,Sarbanes-Oxley, Basel II, UK Metadata, eSign Act, 21 CFR Part 11 (more coming!) Go to View/Master/Slide Master to type in header Customers’ Information Storage and Management...

Ngày tải lên: 24/04/2013, 20:04

... of mathematic models of wastewater treatment process, revelant modeling software has emerged gradually from the early 1990s, such as GPS-X、SIMBA、WEST、EFOR、 STOAT and ASIM Based on the mathematic ... treatment process Process or units Biological Models Settling Models Influent Anaerobic Models Filtration Models Miscellaneous Models Mathematical Models ASM1, ASM2, ASM2d, ASM3, Mantis, General, ... operation control and administration In some WWTPs, wastewater analytical apparatuses and data transferring equipments are collocated sufficiently with periodical and effective maintenance, and...

Ngày tải lên: 05/09/2013, 09:08

... (Spin Trapping) Photolysis of organolead, -tin, and mercury Compounds J Am Chem Soc., 91, 4481-4490 Morioka T., Motoyama N., Hoshikawa H., Murakami A. , Okada M and Moniwa T (1993) Kinetic analysis ... Utsumi H., Hakoda M. , Shimbara S., Nagaoka H., Chung Y and Hamada A (1994) Active oxygen species generated during chlorination and ozonation Water Sci Technol., 30, 91-99 Utsumi H., Han S.K and ... OH radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory-scale and pilot-plant scale reactors, and...

Ngày tải lên: 05/09/2013, 09:38

Ngày tải lên: 06/09/2013, 01:10

... e-mail being sent using (MailMessage message = new MailMessage(mailFrom, MailTo, subject, body)) { message.IsBodyHtml = true; message.Attachments.Add(new Attachment(fileName)); SmtpClient mailClient ... CreateDate TextAlign Left CustomerName Value =Fields!CustomerName.Value ComplaintType Value =Fields!ComplaintType.Value table1 DataSetName dsComplaint_dtComplaintList table1.TableRow1 RepeatOnNewPage True ... Value Create Date textbox3 Value Customer Name textbox10 Value Complaint Type ComplaintID Value =Fields!ComplaintID.Value CreateDate Value =Fields!CreateDate.Value CreateDate Format d CreateDate...

Ngày tải lên: 05/10/2013, 08:48