... materials for both aircraft and structural applications The inside of the feather shaft is filled with air at the calamus (proximal end) and foam (medulla) at the rachis (middle and distal shaft) ... such as manned or unmanned aerial vehicles Experimental Section Materials: Flight feather shafts from a California gull (juvenile) and an American crow were used for structural analysis and mechanical ... shaft, Yang Yu and Tarah Sullivan for help in performing pure bending tests, and Vincent Sherman and Pavithran Maris for providing feedback The authors thank Raul Aguiar and Rancho la Bellota
Ngày tải lên: 04/12/2022, 15:04
... methodological limitations - a systematic review Anja Frei* 1,2 , Anna Svarin 3 , Claudia Steurer-Stey 1,2 and Milo A Puhan 3,4 Address: 1 Department of General Practice and Health Services Research, ... Foundations and by an unrestricted grant for Chronic Care and Patient education from AstraZeneca Switzerland. References 1. Bandura A: Self-efficacy: Toward a unifying theory of behavio- ral change. ... electronic database search. AS (reviewer 1) and AF (reviewer 2) assessed the abstracts and titles and screened full text of the identified studies for relevant data extraction. MP was reviewer 3, CS reviewer
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Self-efficacy instruments for patients with chronic diseases suffer from methodological limitations - a systematic review" docx
... methodological limitations - a systematic review Anja Frei* 1,2 , Anna Svarin 3 , Claudia Steurer-Stey 1,2 and Milo A Puhan 3,4 Address: 1 Department of General Practice and Health Services Research, ... Foundations and by an unrestricted grant for Chronic Care and Patient education from AstraZeneca Switzerland. References 1. Bandura A: Self-efficacy: Toward a unifying theory of behavio- ral change. ... electronic database search. AS (reviewer 1) and AF (reviewer 2) assessed the abstracts and titles and screened full text of the identified studies for relevant data extraction. MP was reviewer 3, CS reviewer
Ngày tải lên: 20/06/2014, 16:20
báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc
... health worker's perceived and actual needs change with time, place and clinical caseload Needs vary also according to availability of diagnostic, treatment and referral facilities And they may ... epidemiology and health care services The RAPIA (Rapid Assessment Protocol for Insulin Access) approach [43] promises to be a practical approach that can be readily adapted to evaluate health care services ... Jabbour S, Nishtar S, Prabhakaran D, Chockalingam A, Achutti A, Agrawal A, et al.: Information and communication technology in cardiovascular disease prevention in developing countries: hype and
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx
... on a BD FACSCalibur flow cytometer and data acquisition and analysis were performed as above Data are from three unique donors and expressed as a fraction of labeled cells within a live-cell gate ... Genetech, San Francisco, CA), anti-TNFa (Humira, Abbott, Abbott Park, IL), anti-IL-1b (clone AB-206-NA, Abcam, Cambridge, MA), anti-IL-6 (clone AB-201-NA, Abcam), anti-GM-CSF (clone BVD2), anti-TGFb ... isolated by magnetic bead separation (Miltenyi Biotec) and used for functional studies Arginase activity was measured in cell lysates using Bioassay Systems’ QuantiChrom Arginase Assay Kit (Hayward,
Ngày tải lên: 18/06/2014, 19:20
how do i get a business loan insider help from a veteran loan officer doc
... you have a significant amount of preparation to justify that loan amount). Let’s say you have an idea for a business you want to start. I’m using a start-up business as the case study because ... $8,500 based... Hmm What else then? How about the equity Natalie has in her house? That can be used The drawback is that it already has a loan against it If you had to sell Natalie's home ... sales agent licensees, and about 25% of his continuing... it means In our case study, Natalie has a FICO score of 814 and a BK score of 240 What does that say? It means that Natalie has an
Ngày tải lên: 27/06/2014, 23:20
Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx
... 2006;24:610-618 Ukai R, Honmou O, Harada K et al Mesenchymal stem cells derived from peripheral blood protects against ischemia J neurotrauma 2007;24:508-520 Pittenger MF, Mackay AM, Beck SC et al Multilineage ... remain a homeostasis in peripheral blood that a little mesenchymal population circulates under normal condition, and only when monocytes are consumed in the regeneration and repair ... evidence that peripheral blood contains common hemato- poietic-mesenchymal progenitors from both hematopoietic and mesenchymal lineages, and CD34 + mesenchymal progenitors are a possible alternative
Ngày tải lên: 08/08/2014, 18:20
Báo cáo y học: "nhibition of established collagen-induced arthritis with a tumour α necrosis factor-α inhibitor expressed from a self-contained doxycycline regulated plasmid" pptx
... those with a clinical score of 2 or less at the time of DNA injection (day 27) are illustrated in panels c and d; and animals with a clinical score greater than 2 at the start of treatment are ... in DBA/1 mice A comparative study using anti-TNF alpha, anti-IL-1 alpha/beta, and IL-1Ra Arthritis Rheum 1996, 39:797-809 23 Bohl D, Naffakh... gene transfer mediated by an adeno-associated ... expression and increase the magnitude of regulation, as was recently achieved with an adenoviral vector [28]. According to data obtained in clinical trials, transfection of human skeletal muscle with
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "The shunt from the cyclooxygenase to lipoxygenase pathway in human osteoarthritic subchondral osteoblasts is linked with a variable expression of the 5-lipoxygenase-activating protein" doc
... TG-3' (antisense), and 5'-AAT GGG AGG AGC TTC CAG AG-3' (sense) and 5'-ACC AAC CCC ATA TTC AGC AG-3' (antisense). To ensure equivalent loading, glyceraldehyde-3-phosphate ... cycles. After amplification, DNA was analyzed on an agarose gel and revealed by ultraviolet detec- tion. Densitometric analysis was performed for each amplimer against that for GAPDH with a ChemiImager ... system's manual (Pierce, Brockville, Ontario, Can- ada). COX-2 levels were determined with a polyclonal rabbit anti-human COX-2 antibody (Cayman Chemical-Cedarlane, Hornby, Ontario, Canada) at
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: " Effects on osteoclast and osteoblast activities in cultured mouse calvarial bones by synovial fluids from patients with a loose joint prosthesis and from osteoarthritis patients" pdf
... used in all experiments Animal care and experiments were approved and conducted in accordance with accepted standards of humane animal care and use as deemed appropriate by the Animal Care and Use ... and RNA was extracted from individual bones and subsequently used for analyses RNA extraction and cDNA synthesis Total RNA was extracted from calvarial bones with TRIzol LS reagent in accordance ... release from neonatal mouse calvarial patients with acalcium 45 (45Ca) but not by SFs from healthy individualsbones by synovial fluids (SFs) from patients with osteoarthritis (OA) and patients with
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: " Paratuberculosis control: a review with a focus on vaccination" ppt
... or vaccination with avian type mycobacteria and allows to rule out mammal tuber- culosis infection according to standardized criteria. An additional drawback to MAP vaccinatio n, which at least ... REVIEW Open Access Paratuberculosis control: a review with a focus on vaccination Felix Bastida 1 and Ramon A Juste 2* Abstract Mycobacterium avium subsp. paratuberculosis (MAP) infection causes ... prevent the appearance of clinical cases, and slightly decrease the transmission risk. Additional problems with paratuberculosis ELISA are that sample handling appears to affect substantially the
Ngày tải lên: 11/08/2014, 08:21
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
... mem- brane), small arrow heads (immature viruses); (D): arrow (plasma membrane), large arrow heads (Golgi apparatus), small arrow (cell associated vesicle); (E): arrow (plasma membrane), arrow ... of vaccinia virus strains replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) in mammalian cells Acta Virol 2001, 45:243-247 Vanderplasschen A, Pastoret ... arrow heads (CEVs); (F): arrow (plasma mem- brane), large arrow heads (EEVs), small arrow head (plasma membrane projection). The same results were obtained with MVA-HANP and Rec 3 (data not shown).
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps
... mem- brane), small arrow heads (immature viruses); (D): arrow (plasma membrane), large arrow heads (Golgi apparatus), small arrow (cell associated vesicle); (E): arrow (plasma membrane), arrow ... of vaccinia virus strains replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) in mammalian cells Acta Virol 2001, 45:243-247 Vanderplasschen A, Pastoret ... arrow heads (CEVs); (F): arrow (plasma mem- brane), large arrow heads (EEVs), small arrow head (plasma membrane projection). The same results were obtained with MVA-HANP and Rec 3 (data not shown).
Ngày tải lên: 12/08/2014, 04:21
báo cáo khoa học: " Complementation of a phycocyanin-bilin lyase from Synechocystis sp. PCC 6803 with a nucleomorph-encoded open reading frame from the cryptophyte Guillardia theta" pot
... without its putative transit peptide by using the primers 222komp2_f (5'-CAT ATG AAT TAA AAC CAA TCC TTA ATT G -3') and 222komp_r (5'-GTT AAA ATT AAA TGA ATT CTA ATA A- 3') Two pairs of primers ... 282:30295-30302 Matsuzaki M, Misumi O, Shin IT, Maruyama S, Takahara M, Miyagishima SY, Mori T, Nishida K, Yagisawa F, Yoshida Y, Nishimura Y, Nakao S, Kobayashi T, Momoyama Y, Higashiyama T, Minoda A, Sano ... K, Hayashi H, Ohta F, Nishizaka S, Haga S, Miura S, Morishita T, Kabeya Y, Terasawa K, Suzuki Y, Ishii Y, Asakawa S, Takano H, Ohta N, Kuroiwa H, Tanaka K, Shimizu N, Sugano S, Sato N, Nozaki
Ngày tải lên: 12/08/2014, 05:20
Báo cáo sinh học: "Reconstructing phylogenies from noisy quartets in polynomial time with a high success probability" docx
... biology. The evolutionary history, referred to as phylogeny, of a set of taxa can be mathematically defined as a tree where the leaves are labeled with the given taxa and the internal nodes repre- ... taxa, and m is a value based on the quartet distance model. These meth- ods tend to be much slower than those in the first category but have higher accuracy. For datasets with a relatively large ... probability Gang Wu* 1 , Ming-Yang Kao* 2 , Guohui Lin 1 and Jia-Huai You 1 Address: 1 Department of Computing Science, University of Alberta, Edmonton, Alberta T6G 2E8, Canada and 2 Department
Ngày tải lên: 12/08/2014, 17:20
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... heparan sulfate and dermatan sulfate GAGs are physiological activa- tors of HC-II, many different polyanions, including polyphosphates, polysulfates and polycarboxylates, are able to accelerate HC-II ... Austra- lian Research Council, the National Heart Founda- tion of Australia (to RNP and AMB), Research Grants HL-06350 and HL-32656 from the National Institutes of Health (to FCC), the Institut National de ... by der- matan sulfate. Ann N Y Acad Sci 556, 116–122. 60 Maimone MM & Tollefsen DM (1990) Structure of a dermatan sulfate hexasaccharide that binds to heparin cofactor II with high affinity....
Ngày tải lên: 20/02/2014, 02:21
With a Little Help pptx
... they take you away and then later, they always find a reason to keep you away." Lawrence's hackles were coming up. He found stuff that didn't belong in the data — he didn't arrest ... doesn't really care about space travel. It used to, or at least when I was growing up all the science fiction I read promised that space travel would someday be commonplace. That was what made it ... room lit by candles and draped with gathered curtains that turned the walls into the proscenia of a grand and ancient stage. There were four or five small tables and a long one at the back of the...
Ngày tải lên: 06/03/2014, 14:20
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
... Fremont A, Khan DC, Huang D, Knapp H, Karaman D, et al: Lay patient navigator program implementation for equal access to cancer care and clinical trials: essential steps and initial challenges. Cancer ... patients, a standard that could be met by using an NN to make need assessments, link appro- priate services to patients and make a subsequent follow-up and evaluation. Their advice was that all can- cer ... instance be done by a lay community peer, a medical assistant, a social worker or a cancer survivor with minor courses in healthcare [5,12]. It can also be done by a nurse (a Nurse Navigator...
Ngày tải lên: 13/02/2014, 06:20
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
... 489–495. 4 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masu- da S, Matsunaga N & Okada H (1981) Purification and characterization of 6-aminohexanoic acid oligomer hydrolase of Flavobacterium sp. ... S & Higuchi Y (2005) Crystallization and x-ray diffrac- tion analysis of 6-aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72. Acta Crystallogr F61, 928–930. 15 Hatanaka HS, Fujiyama ... Kinoshita S, Negoro S, Muramatsu M, Bisaria VS, Sawada S & Okada H (1977) 6-Aminohexanoic acid cyclic dimer hydrolase: a new cyclic amide hydrolase produced by Achromobacter guttatus KI72....
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG 3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA Reverse GCTA GGATCCCTAGCAACCACGGCAC Table 2. Antifungal activity of WAMP- 1a. IC 50 is the concentration necessary for 50% growth inhibition. Fungi ... kiharae seeds with a unique 10-cysteine motif Tatyana I. Odintsova 1 , Alexander A. Vassilevski 2 , Anna A. Slavokhotova 1 , Alexander K. Musolyamov 2 , Ekaterina I. Finkina 2 , Natalia V. Khadeeva 1 ,...
Ngày tải lên: 07/03/2014, 02:20