wallet an element of a cardholder that creates the protocol and
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, pp.65-68 Al-Issa, A ... assurance and hopefulness 1.3.9 Voice Voice of presenter has the capacity for great variety and advantages Varying vocal qualities adds interest and meaning to the messagesof the presenters The ... substantiation and examples, and their proofs and illustrations The goal of this part is to convey to the audience the importance of the topic Conclusion is the last part; it summarizes the main ideas...
- 50
- 454
- 2
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
... perpendicular to the helical axis in panels A and B, and is parallel to the helical axis in panels C and D rapid exchange of the Hz amino protons This observation indicates that the lysine side-chains are ... spectra of NATA (a and b) and D16W-D24)37 GGN4 (c and d) in water (a and c) and in 10 mM SDS micelles (b and d) were measured with an excitation wavelength of 280 nm positioned among the acyl chains ... showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with a slight helical propensity [17,22,23] Especially, the...
- 8
- 447
- 0
báo cáo hóa học:" An application of principal component analysis to the clavicle and clavicle fixation devices" doc
... represented the variations in medial depth and angle, and width and thickness dimensions respectively Finally, each clavicle was approximated as a linear combination of the four PCs The range of PC values ... and shapes Secondly, and Figure 12 Examples of clavicle fixation plates Example of a full range in size and shape of clavicle fixation plates Figure 13 Variation in clavicular width Clavicular ... represents a training set of landmark data using the Figure Clavicle models Source and target clavicle models mean landmarks and a set of eigenvectors which represent the linearly independent modes of...
- 8
- 449
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
MULTIPLE, NUTRIENT SENSING KINASES CONVERGE TO PHOSPHORYLATE AN ELEMENT OF Cdc34 THAT INCREASES SACCHAROMYCES CEREVISIAE LIFESPAN
... (5’-ATCCAAACGTTTACGAGAATGGCGACCTTTGTATTTCTATTTT) and reverse primer (5’-AAAATAGAAATACAAAGGCTCCGATTCTCGTAAACGTTTGGAT) To construct the pRC004 plasmid, the plasmid AD002 was used as template and ... ACTTTTTTCAAGGCTGAGAATCCATCGACAGATTGTAACGAAGCAGCTGAAGCTTCGTACGC- 3’) and CDC34R2 (5’- TGCTCTGTATAGTTCAATAGAATCTTACAGTACATCACGCTGCAAGCATAGGCCACTAGTGGATCTG - 3’) using the PCR cocktail and conditions as described ... 97AF2 (5’-GGGATGGCAGGCTTTGTATTGCTATTTTACACCAAAGTGGG) and 97AF2 (5’-CCCACTTTGGTGTAAAATAGCAATACAAAGCCTGCCATCCC) were used Following PCR amplification, µl of the Dpn I restriction enzyme was added...
- 145
- 97
- 0
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... types handle Computer agents (in the short and medium term) will handle standard tasks and all those tasks that a computer program (i.e an agent) can faster or better than a human can Human intermediaries ... Information access and management is an area of great activity, given the rise in popularity of the Internet and the explosion of data available to users It is the application area that this thesis ... guides and indexing agents is that their actions and suggestions are based on a relatively weak model of what the user wants and what information is available at a suggested location An attempt...
- 100
- 811
- 3
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... the study, collected the data, performed the statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved ... (patient safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of ... Foundation for Acute Medicine and a research fellowship from the Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak,...
- 6
- 611
- 0
an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... types handle Computer agents (in the short and medium term) will handle standard tasks and all those tasks that a computer program (i.e an agent) can faster or better than a human can Human intermediaries ... Information access and management is an area of great activity, given the rise in popularity of the Internet and the explosion of data available to users It is the application area that this thesis ... guides and indexing agents is that their actions and suggestions are based on a relatively weak model of what the user wants and what information is available at a suggested location An attempt...
- 100
- 412
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work ... is the multi-disciplinary team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and...
- 8
- 492
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... lipopolysaccharide gave a pellet and an upper phase, the latter containing most of the material SDS/PAGE of the two materials Fig SDS/PAGE of the upper phase (1) and the pellet (2) obtained on ultracentrifugation ... in the upper phase and the pellet showed identical patterns and it was therefore concluded that the same polysaccharide was present A hydrolysate of the upper phase, analyzed as alditol acetates, ... observed at d 2.75 and 1.68, the large difference establishing the presence of an axial carboxyl group and an a- linkage in the NeuAc residue Signals for N-acetyl groups deriving from NeuAc and GalNAc...
- 7
- 463
- 0
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot
... solutions of the analytes and the internal standards were prepared both in methanol and hexane and stored at 7°C The working standard solutions were prepared by further diluting the stock standard ... For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The limit of detection and the LOQ were calculated on the basis of ... http://www.enveurope.com/content/24/1/2 and biological analyses Therefore, toxicity of total wastewater (liquid and particulate phases) might be higher than that reported in this paper Pharmaceuticals and PAHs The selection of the...
- 13
- 589
- 0
An autobiography of a story book pptx
... would then be able to lead a more comfortable life Perhaps I can invent cars that are operated by robots or a computer that thinks like a human My parents think highly of my ambition and are very ... One day a few girls entered the shop They laughed and joked among themselves They were browsing through the books and one of them picked me up She was attracted to me and bought me immediately ... understand the answer In class, I always make sure that I perform each science experiment properly When in doubt, I consult my teachers As a scientist, I would be able to invent new things for mankind...
- 6
- 385
- 0
An autobiography of a pen doc
... skins and then crawled out of the old ones We then turned into large grey, yellow and orange striped caterpillars My next stage was the pupa stage I crawled under a leaf of the plant and spun a pod ... leaf of a milkweed plant After several days we hatched into tiny black and white larvae At this stage we were called tiny caterpillars We moved about the plant and fed on its fleshy green leaves ... dark corner of the drawer hoping that one day she might use me again An autobiography of a butterfly I am a beautiful Monarch butterfly My name is Jolly My mother laid some eggs on the leaf of...
- 6
- 438
- 0
An autobiography of a dancing doll ppsx
... lady came to the store She looked around the place and her eyes felon me She looked at me in admiration She at once bought me I was given as a birthday present to her only daughter Pam I was ... looking at the other toys and I enjoyed watching the children playing with them Some of them would stop to admire me with wide open eyes, but I was too expensive to be bought One day a rich, grandly ... let her friends handle me When Pam was not attending to me, one of her friends picked me up Pam was furious and tried to pull me away form her friend In the tussle they accidentally ripped my pretty...
- 4
- 233
- 0
Báo cáo toán học: "An extension of a criterion for unimodality" pps
... Geometry: an update Contemporary Mathematics, 178, 71-84, 1994 [4] Stanley, R.: Log-concave and unimodal sequences in algebra, combinatorics and geometry Graph theory and its applications: East and ... conditions of [2] the polynomial P (x + n) is unimodal for any n ∈ Æ , the set of positive integers We also characterize the unimodal sequences {dj } that appear in [2] and discuss the behavior of the ... n+1 Theorem 2.2 Let ≤ a0 ≤ a1 · · · ≤ am be a sequence of real numbers and n ∈ Æ , and consider the polynomial P (x) = a0 + a1 x + a2 x2 + · · · + am xm Then the polynomial P (x + n) is unimodal...
- 7
- 331
- 0
Báo cáo y học: "Standards of evidence in chronobiology: critical review of a report that restoration of Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food anticipatory rhythms in Bmal1-/- mice" pot
... Shin Yamazaki, Wataru Nakamura and Takahiro Moriya for sharing unpublished data, and many colleagues and three anonymous reviewers for comments and support References Schwartz WJ: Suprachiasmatic ... Fuller etand[12]© (2008) AAASthat received intra-DMH AAV-BMAL1 injecBmal1 and Per1 expression in a Bmal1+/- control mouse and a Bmal1-/- mouse that received intra-DMH AAVBMAL1 injections bilaterally ... that the waveform in Fig S3D (Figs and here) is misaligned and that temperature rises in anticipation of mealtime at least an hour earlier than this figure suggests The data therefore appear...
- 13
- 349
- 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps
... by the American Foundation for AIDS Research (amfAR) Grant 02882-32-RGV, National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 to F.R.F and National ... MA, 02115 USA 3Loma Linda University Cancer Center, Loma Linda, CA 92354, USA 4Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA 02115 USA 5Division of Research ... and LG, participated in performing the ELISPOT assays JBW and LG performed the proliferative assays JBW and SM performed the flow cytometric assays JBW and SYL analyzed the immunology data RBR performed...
- 7
- 393
- 0
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa
... Halliday‘s functional approach to language Halliday‘s framework emphasized the social function of language and the thematic and informational structure of speech and writing According to McCarthy ... participants‖ Farhady (2005) believes that the meaning of the text depends both on the meanings of the words and sentences, and on the logic behind the text and readers; in order to understand ... language (i.e., cultural and 10 ideological meanings) and lower-order forms of language that contribute to patterning the meaning In layman‘s terms reader cannot neglect the role of individual...
- 66
- 703
- 0
The introduction of a system that would improve a manager’s ability to successfully supervise their employees, operating companies has been identified as a solution
... it allows for the data to be easily updated and an instant analysis of the results can be easily created by clicking the create scores button The system is also based in a platform that many ... Perform a successful handover to the stakeholders Statistical analysis of employee and goods data Evaluate the performance of the new system Has it improved the way we manage our people II LITERATURE ... data from within the database A login system can also be created by using data in the database where the login details will be stored in the database and the system will validate the information...
- 31
- 448
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25