... concentration of the mL supernatant was about 25 mgÆmL)1 as measured with the Quick Start Bradford Protein Assay (BioRad, Hercules, CA, USA) using bovine serum albumin as standard It contained almost ... function of a protein, additional information about post-translational modifications, like 2895 Signal peptidase I activity in M pneumoniae Fig SIGNAL P predicted and experimentally verified cleavage site ... kDa As the molecular mass of P40 in protein extracts, measured by SDS ⁄ PAGE is about 36 kDa, there is an obvious difference in molecular mass of about kDa between the calculated and the actually...
Ngày tải lên: 19/02/2014, 18:20
... antisense: 5¢-AGATGCGGCCGCTTAATTCTCCC TCAAGATCTTATTGATCC-3¢ for rMCP-5, and sense: 5¢-GACTGAATTCATGCATCTTCTTGCTCTTCAT-3¢ (A) and antisense 5¢-GACTGCGGCCGCTTAATTCTC CCTCAAGATCTTATTG-3¢ (B) for ... method of Ho et al [31] The cDNA of the V216G mutant of mMCP-5 was generated by recombinant PCR using a mutagenic primer pair (sense: 5¢-CAAGGCATTGCATC CTATGGACATCGGAATGCAAAGCCC-3¢, and antisense: ... mMCP-5 was obtained from the SWISSPROT [32] database A homology search of the Protein Data Bank was carried out by using the FASTA and BLAST programs, and human chymase, rat mast cell protease (rMCP)-2,...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
... the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia ... and 1% (v ⁄ v) acetonitrile overnight at 37 °C with agitation Statistical analyses All results are expressed as mean ± standard error (SE), except where indicated Data were analyzed using graphpad ... compilation ª 2008 FEBS 3489 PCSK9 circulates as a phosphoprotein in humans T Dewpura et al presence of a general protease inhibitor cocktail (Roche, Laval, Canada) and 200 lm sodium orthovanadate...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc
... the cDNA was carried out using the respective gene-specific primers: ICAM-1 5¢- CTGATGGGCAGTCAACAGCTAAAA - 3¢(sense) 5¢- TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2 5¢-ATGAGATTGTGGGAAAATTGCT- ... TLR signalling 5¢- GAATTCTCAGCCCTCTTCAAAAAC -3¢ (antisense) b-actin, an internal control, was also amplified using the following primers: 5¢- TCC TCC CTG GAG AAG AGC TA - 3¢ (sense) 5¢- AGT ACT TGC ... Proc Natl Acad Sci USA 97, 13766–13771 Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, Takeda K & Akira S (1999) Differential roles of TLR2 and TLR4 in recognition of Gram-negative and...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
... function as an AFP as well as its relationship to other CTLDs MATERIALS AND METHODS Materials N-Glycosidase F and endoproteinase Glu-C were obtained from Roche Molecular Biochemicals (Laval, Canada) ... use Approximately 2.5 mL plasma was fractionated on a · 90 cm S-200 Sephacryl (Pharmacia, Uppsala Sweden) gel-filtration column Fractions containing AFP, as determined by SDS/PAGE, were then applied ... band corresponded to the gradual increase in intensity of a higher-molecular-mass band The apparent molecular mass of this band was 38 kDa, which is substantially higher than the molecular mass...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khoa học: The HS:1 serostrain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups pot
... H4 labeled A2 a, A2 b, A3 a, A3 b, A4 a and A4 b, respectively (Fig 4A) The 1D-NOESY of Gal H- 4a showed NOEs for Gal H- 2a, Gal H- 3a, Gal H-5 and Gal H-6 ⁄ 6¢, as well as for Fru H-4 and Fru H-6 ⁄ 6¢ ... respectively The 31 P chemical shift for the MeOPN groups was 14.67 p.p.m., and a scalar coupling 3JP,H of 11.1 Hz was observed CPS-2 Atom Type dH dC A1 A2 a A2 b A3 a A3 b A4 a A4 b A5 A6 ⁄ A6 ¢ B1 ⁄ B1¢ B2 B3 ... GB (1999) Isolation and chemical characterization of a capsular polysaccharide antigen shared by clinical isolates of Enterococcus faecalis and vancomycin-resistant Enterococcus faecium Infect...
Ngày tải lên: 30/03/2014, 20:20
page-a-minute memory book
... Illinois Central Gulf Railroad; Wal-Mart Stores, Inc.; St Paul Companies; Pratt & Whitney; International Paper Company; A C Nielsen Company of Canada; DuPont Canada, Inc.; Santa Fe Energy Company; United ... For example: Calamari—squid You collar a girl named Mary (collar Mary—calamari) and force her to eat squid Aglio (pronounced al-yo)—garlic Many people smell of garlic You say to them, "All you ... But what about names like Carruthers, Bentavagnia, Ponchatrane, Tropeano, Harrison, Smith, Gardner, Cohen, Sitron, Swanson, Rafferty, Krakowitz— the vast majority of names that have no meaning?...
Ngày tải lên: 31/05/2014, 01:10
Báo cáo hóa học: " A predominance of R5-like HIV genotypes in vaginal secretions is associated with elevated plasma HIV-1 RNA levels and the absence of anti-retroviral therapy" docx
... ethylenediaminetetraacetic acid (EDTA) anticoagulant tubes, and plasma aliquots were stored frozen at -80°C HIV contained in plasma and vaginal secretion supernatant samples was collected by centrifugation ... conducted HTA analyses, participated in PCR sample preparation, carried out data analysis, and drafted the manuscript PK participated in the study design and conducted the statistical analyses RC participated ... plasma and vaginal compartments was observed in this cohort, 50 to × 105 copies/mL plasma and 50 to × 105 copies/vaginal sample For statistical analysis, HIV RNA levels in both plasma and vaginal...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " A cylindrical core-shell-like TiO2 nanotube array anode for flexible fiber-type dye-sensitized solar cells" pptx
... preparation of nanomaterials J Mater Chem 1997, 7:1075 Masuda H, Yasui K, Nishio K: Fabrication of ordered arrays of multiple nanodots using anodic porous alumina as an evaporation mask Adv Mater ... the amorphous TNTs and underlying TiO2 barrier layer turned into polycrystalline anatase after being annealed at 450°C The cylindrically core-shell -like TNT array of various structural parameters, ... characterization of TNT array The structures of the hierarchical crystalline TiO2 array are shown in Figure A schematic drawing of an anodized Ti wire consisting of an inner Ti core and a TNT array...
Ngày tải lên: 21/06/2014, 06:20
A house I would like to live in pptx
... “roti prata”, “soup kambing” and other Malay food in a hawker centre at Hill Street Fadley’s parents are very hardworking They wake up early each morning to go to the market and to prepare the ... secondary school They often join Fadley and me in our games His sister is pretty and has a winsome smile She is seldom at home as she works every day as a salesgirl in Metro Grand Fadley’s grandparents ... brothers and one sister Since Fadley is the youngest in the family, his grandparents and parents dote on him Fadley’s parents are hawkers They sell “roti prata”, “soup kambing” and other Malay food...
Ngày tải lên: 22/07/2014, 04:20
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx
... Leader peptide domain 5'-CAACACUCGCAAUAUU-3'(sense) 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain ... domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) 3'-UUACACUACUUAUCCUCCACU5'(antisense) Cytoplasmic membrane domain 5'-UAGAGCUCUGAUAGAUCUCUU-3'(sense) 3'-UUAUCUCGAGACUAUCUAGAG5'(antisense) France, Illkirchcedex), ... AGGTCTTAT GGTGCTGTCAC-3', Anti sense: 5'- TGT Page of 12 GTAATTCTGCTCCTTCC -3'; β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG...
Ngày tải lên: 11/08/2014, 03:20
báo cáo khoa học: " A plant natriuretic peptide-like molecule of the pathogen Xanthomonas axonopodis pv. citri causes rapid changes in the proteome of its citrus host" pptx
... coli as an His-tag N-terminal fusion protein Briefly, XacPNP was amplified by PCR using this pair of oligonucleotides: NPNPB (5’ ATCAGGATCCGACATCGGTACAATTAGTT 3’) and CPNPH (5’ ATACAAGCTTT TAAATATTTGCCCAGGGCG ... between ABA and PNP; ABA suppresses salicylic acid (SA) biosynthesis [67,70] and SA in turn has a marked effect on AtPNP -A transcript accumulation in Arabidopsis In mutants with elevated SA levels ... M, Sayed M, Wherrett T, Shabala S, Gehring C: A recombinant plant natriuretic peptide causes rapid and spatially differentiated K+, Na+ and H+ flux changes in Arabidopsis thaliana roots Plant...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: "A poxvirus Bcl-2-like gene family involved in regulation of host immune response: sequence similarity and evolutionary history" pptx
... strain W-848-83; MYXV-LAU, myxoma virus strain Lausanne; RFV-KAS, rabbit fibroma virus strain Kasza; VACV-WR, vaccinia virus strain Western Reserve; YLDV-Davis, yaba -like disease virus strain Davis; ... homology search method based on HMM profile vs profile comparisons [19] A Pox _A4 6 family multiple sequence alignment from Pfam database was used as input to run HHpred against a database of all Pfam ... YMTV-Amano, Yaba monkey tumor virus strain Amano; RFV-Kas, Rabbit fibroma virus strain Kasza; SPPV -A, Sheeppox virus strain A; GTPV-G20LKV, Goatpox virus strain G20-LKV; BPSV-AR02, Bovine papular...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " A novel trifunctional IgG-like bispecific antibody to inhibit HIV-1 infection and enhance lysis of HIV by targeting activation of complement" ppsx
... demonstrate that (anti-gp120 × anti-C3d)-Fc can bind to HIV virions and can result in an amplification of the complement activation cascade As a consequence of this action, HIV would likely be ... disease is bispecific antibodies (BsAbs) that can bind to two distinct epitopes Besides the dual-specific antigen binding fragment (Fab) parts, they contain an Fc portion and can Jia et al Virology ... YSZ, YXH participated in developing the hypothesis and collaborated in writing and reviewing of the article All authors read and approved the final manuscript Acknowledgements This work was supported...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Trapped in a vicious loop: Toll-like receptors sustain the spontaneous cytokine production by rheumatoid synoviu" doc
... 13 Abdollahi-Roodsaz S, Koenders MI, Joosten LA, van de Loo FA, van den Berg WB: Toll -like receptor blockade ameliorates murine and humanized Abdollahi-Roodsaz et al Arthritis Research & Therapy ... production and the severity of inflammation in the transplants to the same extent as adalimumab [13] A head-to-head comparison of different TLRs in the valuable ex vivo model used by Nic An Ultaigh and ... of patients From a clinical perspective, however, it is important to consider the substantial heterogeneity among patients with RA Microarray analysis of RA synovial tissues has revealed a noteworthy...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf
... 6:29-32 Takeda K, Kaisho T, Akira S: Toll -like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... of Health and Human Sciences, Georgia State University, Atlanta Presented in part at the Experimental Biology Annual Meeting, April 2009, New Orleans, LA Author details Pathology and Laboratory ... K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated free fatty acidsinduced inflammatory changes in the interaction between adipocytes and macrophages Arterioscler...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx
... 6:29-32 Takeda K, Kaisho T, Akira S: Toll -like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... of Health and Human Sciences, Georgia State University, Atlanta Presented in part at the Experimental Biology Annual Meeting, April 2009, New Orleans, LA Author details Pathology and Laboratory ... K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated free fatty acidsinduced inflammatory changes in the interaction between adipocytes and macrophages Arterioscler...
Ngày tải lên: 11/08/2014, 06:22
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
... sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically synthesized ... system (Amersham Pharmacia Biotech, Uppsala, Sweden) Histone3 (Sigma, St Louis, MO, USA, 1:500) was used as an internal control Statistical analyses Data are expressed as mean ± standard deviation ... once daily for days, starting from day before CCI surgery Evaluation of tactile allodynia and thermal hyperalgesia The paw withdrawal latency (PWL) to radiant heat and paw withdrawal threshold (PWT)...
Ngày tải lên: 25/10/2012, 11:48
How to interview like a top mba
... weak in any of these major areas and expect to get a job at a high level at Procter & Gamble We especially valued candidates with extraordinary leadership abilities We believed a manager who has ... interview like a top MBA In my case, I was a mathematics and economics major in college, and then I taught math for a number of years When I was ready to make the transition to become a financial adviser, ... demonstrating that I knew a great deal about the industry and the available job I had learned as much as possible about the industry and the job I had done my research and was able to speak using...
Ngày tải lên: 11/03/2013, 15:28