... temperature until ethanol and methanol were removed followed by drying in a freeze-dryer. The dry extracts (extractable phytochemicals) represented 24.8% of the rice germ and 16.3% of the rice bran, respectively. ... mode (Figure 3). The prominent negative and positive molecular ion species make ESI-MS a valuable analytical method for detecting vitamin E compounds and determining their structures, especially when ... respectively. The extract was partitioned between water (200 mL) and dichloromethane 3 times (200 mL ì 3). The aqueous layer and combined dichloromethane extract were rotary evaporated under reduced...
Ngày tải lên: 15/03/2014, 15:33
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: "Vitamin E and selenium plasma concentrations in weanling pigs under field conditions in Norwegian pig herds" pps
Ngày tải lên: 12/08/2014, 18:21
.Get More and Do More at Dummies.com ®Start with FREE Cheat SheetsCheat Sheets include • Checklists • Charts • Common Instructions • And Other Good Stuff!To access the Cheat Sheet created specifically for this book, go towww.dummies.com/cheatsheet/e pptx
... for official rules. Get More and Do More at Dummies.com đ To access the Cheat Sheet created specifically for this book, go to www.dummies.com/cheatsheet/exchangetradedfunds Mobile Apps There’s ... make sense. And, above all, I like their expense ratios looooow. At present, plenty of ETFs carry expense ratios of 0.20 percent or less. Some of the newer, more complicated ETFs, however, ... products and very well paid investment-product salespeople, ETFs are the ultimate killjoys. Since their arrival on the investment scene in the early 1990s, more than 1,300 ETFs have been created,...
Ngày tải lên: 16/03/2014, 21:20
c interfaces and implementations techniques for creating reusable software
Ngày tải lên: 04/09/2013, 22:04
Tài liệu Báo cáo khoa học: "The Effect of Corpus Size in Combining Supervised and Unsupervised Training for Disambiguation" pdf
... words, de- pendencies and partial dependencies of a sen- tence are stored together as one docum ent. This storage mechanism enables fast on-line queries for lexical and dependency statistics, e. g., ... relative clauses, no such filtering is nec- essary. For example, spurious subject-verb dependencies due to RC ambiguities are rare compared to a large number of subject-verb dependencies that can be ... not com- pletely unsupervised since the default value and the most frequent attachment were determined based on the development set. 7 We attempted to recreate Siddharthan’s training and test sets,...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc
... 24, 2001), http://sciencecareers.sciencemag.org/career_development/previous_issues/ articles/1120/be_honorable _and_ strategic. Heiberger, Mary M., and Julie M. Vick. The Academic Job Search Handbook. Philadelphia, ... appropriate conduct of research. Reviews cases of unethical conduct by faculty. Human subjects research: Establishes policies for the ethical treatment of human research subjects and ensures compliance ... center provides a free reference service to the public, free bioethics database services, a Syllabus Exchange Clearinghouse for educators, annotated bibliographies, and other services to facilitate...
Ngày tải lên: 21/02/2014, 12:20
Making monitoring and evaluation systerms work a capacity development toolkitInteractive textbook at www/worldbank.org/pdt1. Structure and Organizational Alignment for M&E pptx
... Bank for Reconstruction and Development / The World Bank Preface xxxi Preface Now more than ever, development programs are expected to deliver results. For everyone involved in development, the ... conclusions expressed in this volume do not necessarily refl ect the views of the Executive Directors of The World Bank or the governments they represent. The World Bank does not guarantee the accuracy ... It can be used for M& ;E systems in education, agriculture, tourism, fi nance, civil society, the private sector, and so forth. e) Component use by level and sector: These 12 Components could...
Ngày tải lên: 06/03/2014, 00:22
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
... Program CI Confidence interval CIA Enhanced chemiluminescence CMS Centers for Medicare and Medicaid Services DIS Disease intervention specialist DTaP Diptheria and tetanus toxoids and acellular ... develop a vaccine for hepatitis C, which could substantially enhance hepatitis C prevention efforts. The committee recognizes the need for a safe, effective, and affordable hepatitis C vaccine ... receive appropriate medical management. x 5-2. The Centers for Disease Control and Prevention, in conjunction with other federal agencies and state agencies, should provide resources for the...
Ngày tải lên: 06/03/2014, 01:20
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
... of Sciences, the National Academy of Engineering, and the Institute of Medicine. The members of the committee responsible for the report were chosen for their special competences and with regard ... substantially enhance hepatitis C prevention efforts. The committee recog- nizes the need for a safe, effective, and affordable hepatitis C vaccine and offers the following recommendation: Recommendation ... C http://www.nap.edu/catalog/12793.html vii Reviewers T his report has been reviewed in draft form by persons chosen for their diverse perspectives and technical expertise, in accordance with procedures approved by the National Research...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... fluoro- phore MOCAc is quenched by the chromophoric resi- due Dnp. After cleavage of the peptide, the quenching efficiency is decreased, resulting in an increase in fluorescence. The activity determined ... [14]. CatE-deficient mice are found to develop atopic dermatitis-like skin lesions [15]. It was reported recently that CatE-deficient mice show increased susceptibility to bacterial infection associated ... immobilized on CH-activated Sepharose at 4 C over- night. With this method, the measured increase in fluorescence intensity is exclusively caused by CatD. The difference between total aspartic proteinase...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... Natural Science, Charles University, Prague, the Czech Republic; 3 Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Prague, the Czech Republic; 4 Guilford Pharmaceuticals ... sequence. The clones were used to generate stably transfected Dro- sophila Schneider’s cells, and the expression and carboxy- peptidase activities of the individual protein products were determined. ... C ATTCTCGAGTCATTAGGCTACTTCACTCAAAG 274/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 C; 1 min/56 C; 3 min/72 C CACCTCGAGTTATTATAGCTCAAACACCATCC 44/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 C; 1 min/56 C; 3 min/72 C CACCTCGAGTTATTATAGCTCAAACACCATCC 44/750_V5-His...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: "Phrase Table Training For Precision and Recall: What Makes a Good Phrase and a Good Phrase Pair?" doc
... by (therefore aligned to) a source 1 word e a j ; and (ii) the likelihood function f (f , a |e) specifies a generative procedure from the source sentence to the target sentence. Given a phrase pair ... log-linear model aiming for a balanced precision and recall. We have presented a generic phrase translation extraction procedure which is parameterized with feature functions. It can be optimized ... in a sentence pair, there will be many generative paths that align the source phrase to the target phrase. The likelihood of those generative procedures can be accumulated to get the likelihood...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: Specific biomarkers for stochastic division patterns and starvation-induced quiescence under limited glucose levels in fission yeast docx
... glucose concentrations decreased at the time (6 h) of metabolite extraction, but were very dependent on the cell concentrations. For the case of 4.4 mm glucose and the initial cell con- centration ... identi- fied speci c metabolites (e. g. biotin, trehalose, ergothioneine, S-adenosyl methionine and CDP-choline), which increased or decreased at different glucose concentrations, whereas nucleotide ... Percentage of cells stained by H 2 DCFDA dye is plotted for each observed condition (see A). The number in parentheses indicates the amount of observed cells. (C) Cells were incubated in excess (111...
Ngày tải lên: 14/03/2014, 23:20
HTML5 FOR DUMmIES‰ Q U I C K R E F E R E N C E doc
... the value attribute. Any text you place in the value will become the default value of the form. The text element will place a small box on the screen. When the user selects the box, the cursor ... Publisher Andy Cummings, Vice President and Publisher Mary Bednarek, Executive Acquisitions Director Mary C. Corder, Editorial Director Publishing for Consumer Dummies Diane Graves Steele, Vice President ... movement was never realized. Creating valid XHTML documents proved difficult enough that very few developers tried. Browsers rendered inaccurate XHTML code decently (if not perfectly). In fact,...
Ngày tải lên: 15/03/2014, 19:20
Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx
... 5Â-CGGAATCGAA GCGGTCGACGAGTTCCACAGG 5Â-CCTGTGGAACTCGTCGACC GCTTCGATTCCG W396A SOL 5Â-GAAAAGCAAGAGTTACCCCC GCGTTTATGGCACAGGAAG 5Â-CTTCCTGTGCCATAAAC GCGGGGGTAACTCTTGCTTTTC N435A Between SOL and ... undertaken to identify the active site residues that ensure the specificity of amino acid and tRNA 3Â-end recognition. Residues predicted to contribute to the amino acid spec- ificity were selected ... study, we aimed to characterize the other active site residues, which according to the crystal structure may influence the specificity of substrate recognition. These are marked mMbSerRS active site...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc
... or sequencing artefacts in either of the clones. To prove that the cloned cDNA encoded a vitamin K- dependent carboxylase, we expressed this coding sequence in vertebrate and invertebrate cells. ... vitamin K-dependent carboxylase, and identified structural and functional similarities and differences between invertebrate and verterbrate vitamin K-dependent carboxylases. We demonstrate amino-acid sequence ... The difference in the expression level in the two systems is related to the efficiency of carboxylase expression in these systems. The speci c carboxylase activity of the Conus carboxylase is very...
Ngày tải lên: 17/03/2014, 10:20
Jim ledin embedded control systems in c and c++ an introduction for software developers using MATLAB 2004
... system performance is achieved, you are done. If excessive overshoot and oscillation occur before acceptable response time is achieved, you will need to add a derivative term. If the steady-state ... 1.7 Performance Specifications One of the first steps in the control system development process is the definition of a suitable set of system performance specifications. Performance specifications ... automobile: The cruise control manipulates the throttle setting so that the vehicle speed tracks the commanded speed set by the driver. In years past, mechanical or electrical hardware components performed...
Ngày tải lên: 19/03/2014, 14:09
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf
Ngày tải lên: 22/03/2014, 17:20