... (Ishikawa et al 2006) Ascorbate plays an important role in plants as an antioxidant and as a cofactor of many enzymes (Ishikawa et al 2006) As an antioxidant, ascorbate protects plants from oxidative ... Iqbal R Khan, Rahat Nazar, Asim Masood, and Shabina Syeed 413 429 Contents ix 21 Role of Salicylic Acid in Alleviating Heavy Metal Stress Losanka P Popova, Liliana T Maslenkova, Albena Ivanova, ... 201 0a) , and Brassica juncea (Ahmad 2010; Ahmad et al 2011) SOD activity has also been observed to increase by the application of heavy metals such as cadmium (Shah et al 2001; John et al 2009; Ahmad...
Ngày tải lên: 14/03/2014, 10:20
... GGGAGAAGCATTAGGAGGG CAAGGAAAGCAAGGTGGG 270 NM_000684 b2 -AR 60 Forward Reverse CAGCAAAGGGACGAGGTG AAGTAATGGCAAAGTAGCG 334 NM_000024 COX-2 57 Forward Reverse TTGACCAGAGCAGGCAGATG CCAGAAGGGCAGGATACAGC ... pancreatic carcinoma by aspirin Cancer 2005, 103:2485-2490 26 Takada Y, Kobayashi Y, Aggarwal BB: Evodiamine abolishes constitutive and inducible NF- B activation by inhibiting InBa kinase activation, ... Gene Annealing temperature(°C) Primer sequence Amplicon (bp) Accession No b- actin 60 Forward Reverse ATCGTGCGTGACATTAAGGAGAAG AGGAAGGAAGGCTGGAAGAGTG 179 NM_001101 b1 -AR 60 Forward Reverse GGGAGAAGCATTAGGAGGG...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: "A general framework for quantifying the effects of DNA repair inhibitors on radiation sensitivity as a function of dose" pptx
... i is an indicator which assumes the value zero for the control case, i.e radiation alone, and one for the drug-treated case; and δx – where "x" is any of the parameters above – is the variation ... growth-arrested populations of glioma cells were validated by the model The observation that δz was a significant parameter in all cases, and that the magnitude and direction of this effect varied according ... effect, but the method has limitations Results Firstly, the fitting of these models has always been performed separately on the treated and untreated datasets, making direct comparison of the parameters...
Ngày tải lên: 13/08/2014, 16:21
báo cáo khoa học: " UV-B-induced signaling events leading to enhanced-production of catharanthine in Catharanthus roseus cell suspension cultures" pps
... prior to UV-< /b> B irradiation of and 2.5 µM DCFH-DA was added to the treated cultures The ROS produced was measured as above the enzyme was estimated to be approximately 49 kDa The 49-kDa MBPK activity ... responses Both the treatments blocked the UV-< /b> B- induced stimulation of MBPK and CDPK activities and the UV-< /b> Binduced accumulation of Tdc and Str mRNAs, and catharanthine Because EGTA and verapamil are ... CDPK Then, the activated CDPK would regulate the activation of NADPH oxidase in the plasma membrane and release ROS Finally, downstream of ROS production, the UV-< /b> Binduced and -activated MAP kinases...
Ngày tải lên: 12/08/2014, 05:20
DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM
... effect of adsorption of TCE on the TiO2 powder), as well as the photolysis of TCE by solar radiation only in the absence of TiO2 Figure showed the degradation ratio of TCE as the function of exposed ... the byproducts from the TCE degradation were examined MATERIALS AND METHODS TCE (99+%) was obtained from Aldrich Chemical Co, and the TiO2 used was Degussa P-25, which was mostly anatase and had ... Operation of a solar photocatalytic water: Treatment system at a superfund site Photocatalytic Purification and Treatment of Water and Air, Edited by D F Otlis and H Al-Ekabi, pp 547-556 Raquel...
Ngày tải lên: 05/09/2013, 08:40
Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt
... decreases the enthalpy of the main phase transition of Myr2Gro-PGro substantially whereas GS12 and GS10 actually appear to slightly increase the total enthalpy of the two-component main phase transition ... gel phase with tilted hydrocarbon chains (the Lb¢ phase) to the rippled gel phase with tilted hydrocarbon chains (the Pb¢ phase) and the main phase transition to the conversion of the Pb¢ phase ... antimicrobial potency of these analogs and possibly also for understanding the molecular basis for their differential antimicrobial potencies again different classes and species of bacteria, many of...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... affinity, K, can be derived for both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and dissociation rate constants for the b subunits are found ... yield of BR By contrast, the decrease in the association rate constant for the b subunits occurs with the increase in the quantum yield of BR The results for the b subunits show that there is an ... of Val(E11) in the a and b subunits relative to the heme plane is quite dependent on the nature of the anions and the pD of the solution as well as on the nature of the ligand It has been observed...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Prohibitin is expressed in pancreatic b-cells and protects against oxidative and proapoptotic effects of ethanol pdf
... City, CA, USA) 360 CAGCTTCCTCGTATCTACATTCAAGAGATG TAGATACGAGGAAGCTGTTTTT; 1179 CCATTCTGCCGTATATTGATTCAAGAGA TCAATATACGGCAGAATGGTTTTT; 1624 CTCAGAGATTGCCCTTTCTTTCAAGAGA AGAAAGGGCAATCTCTGAGTTTTT The ... (F) As an additional proof of apoptosis, cleaved caspase-3 was determined in cell extracts by western blot (G) Representative blot of n = experiments showing 17 and 19 kDa caspase-3 cleavage bands ... TO H Actin siR N A J H Lee et al Caspase Caspase Cleaved caspase Cleaved caspase Fig Effect of PHB siRNA on ethanolinduced apoptosis in RINm5F and INS-1E cells RINm5F (A, C,E) and INS-1E (B, D)...
Ngày tải lên: 29/03/2014, 08:20
báo cáo hóa học: " Pro-inflammatory gene expression and neurotoxic effects of activated microglia are attenuated by absence of CCAAT/enhancer binding protein b" potx
... NM_021283, CgAggTCACAggAgAAgggA AAgCCCTACAgACgAgCTCACT Actin NM_007393.3 CAACgAgCggTTCCgATg gCCACAggATTCCATACCCA Rn18s NR_003286.2 gTAACCCgTTgAACCCCATT CCATCCAATCggTAgTAgCg Straccia et al Journal of Neuroinflammation ... gTttCCAATcagccc -16/-31 -173/-188 TCAggAACAgTTgCCATAgC AgACCTATACAACggCTCCT gTTgTgATTCTTTCgATgCT ggAATTgACTATCgTTCTTg TNFa agggTTtgGaAAgtt -336/-351 TCTCATTCAACCCTCggAAA CACACACACCCTCCTgATTg IL10 aggATTGaGaAATaa ... were added and the mixture was incubated at 40 rpm on a rotating wheel for at least h at 4°C Then, the tube was placed on a magnetic rack for The supernatant was discarded and 100 μL of sheared...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Effects of alpha-calcitonin gene-related peptide on osteoprotegerin and receptor activator of nuclear factor-B ligand expression in MG-63 osteoblastlike cells exposed to polyethylene particles" doc
... each well The QuantiChromeTM Alkaline Phosphatase Assay Kit (Cat No DALP-250; BioAssay Systems, Hayward, CA) was used to measure alkaline phosphatase (AP) activity levels in lysate samples of 104 ... included a DNase treatment using the RNase free DNase Set (Qiagen, Hilden, Germany) The yield and purity of the RNA was measured photometrically RNA was analyzed by quantitative real time polymerase ... osteoclast progenitors, and leads to osteoclast activation On the other hand, OPG binds to RANKL and thereby inhibits osteoclast activation The osteoblast function can be described by alkaline...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Effects of alpha-calcitonin gene-related peptide on osteoprotegerin and receptor activator of nuclear factor-B ligand expression in MG-63 osteoblastlike cells exposed to polyethylene particles" pot
... each well The QuantiChromeTM Alkaline Phosphatase Assay Kit (Cat No DALP-250; BioAssay Systems, Hayward, CA) was used to measure alkaline phosphatase (AP) activity levels in lysate samples of 104 ... included a DNase treatment using the RNase free DNase Set (Qiagen, Hilden, Germany) The yield and purity of the RNA was measured photometrically RNA was analyzed by quantitative real time polymerase ... osteoclast progenitors, and leads to osteoclast activation On the other hand, OPG binds to RANKL and thereby inhibits osteoclast activation The osteoblast function can be described by alkaline...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: "Effects of Pin-up Oxygen on [60]Fullerene for Enhanced Antioxidant Activity" pptx
... peroxyl radical; (a) decay curves of absorbance at 460 nm (Abs460) and (b) plots of ln (Abs0/Abst) versus time in the presence of antioxidants (10 lM), where Abs0 is initial Abs460 and Abst is Abs460 ... pseudofirst-order rate constants kobs of b- carotene bleaching with linoleic acid peroxyl radical at 50°C Values of kobs were obtained by monitoring the absorbance of b- carotene aqueous solution (8.2 lM) at 460 ... evaluating antioxidant activity The method is based on the discoloration of the yellowish color of a b- carotene solution due to the breaking of p-conjugation by the addition of lipid peroxyl radical...
Ngày tải lên: 22/06/2014, 01:20
Báo cáo khoa học: "Influence of gestational age at exposure on the prenatal effects of gamma-radiation" pps
... lumbar vertebrae Abnormal arrangement of lumbar vertebrae Fusion of thoracic vertebrae Absence of ribs Fusion of ribs Bifurcation of ribs Shortening of ribs Displasia of sternebrae Missing of ... from the tip of the snout to the base of the tail The longitudinal distance from the tip of the snout to the base of the skull was recorded as head length The distance between the two ears was ... Internal malformation Fetuses examined Dilatation of cerebral ventricle Stenosis of nasal cavity Cleft palate Dextrocardia Levorotation of heart Abnormal lobation of lung Detect of diaphragm Diaphragmatic...
Ngày tải lên: 07/08/2014, 14:23
Báo cáo khoa học: " Dose-Incidence Relationships on the Prenatal Effects of Gamma-Radiation in Mice" pdf
... vertebrae Fusion of thoracic vertebrae Absence of ribs Fusion of ribs Wavy ribs Hypoplasia of ribs Displasia of sternebrae Missing of sternebrae Hypoplasia of sternebrae Curvature of tibia Absence ... ventricle, dilatation of renal pelvis and abnormalities of the extremities and tail With increasing radiation dose, cleft palate, dilatation of cerebral ventricle and abnormalities of the extremities ... distance from the tip of the snout to the base of the skull was recorded as head length The distance between the two ears was recorded as head width Measurements were made with a vernier callipers...
Ngày tải lên: 07/08/2014, 15:20
Báo cáo khoa học: " Modulatory effects of chitosan adipate on the T and B lymphocyte subsets in mice" pps
... yb detcerroc erew sesac lla dna ,nairaniretev a yb noitatlucsua lanimodba nopu dnuos gnignip a yb desongaid saw tnemecalpsid lasamobA mutraptsop skeew nihtiw denrecnoc remraf eht ro/dna nairaniretev ... laetul( kciht mm naht retaerg llaw a htiw ro )tsyc ralucillof( kciht mm naht ssel llaw a htiw retemaid lanretni mm 52 naht regral fo serutcurts nairavo no desab erew snoitaulave cihpargonosartlU ... nairaniretev a yb devresbo sngis lacinilc yb desongaid erew )sisotek ro ,revef klim ,tnemecalpsid lasamoba( sredrosid cilobateM ]52,5[ h 42> rof enarbmem latef eht fo noitneter eht sa denifed saw atnecalp...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "The Akt-inhibitor Erufosine induces apoptotic cell death in prostate cancer cells and increases the short term effects of ionizing radiation" pot
... ErPC3; PARP-cleavage was accompanied by a weak activation of caspase-3 detectable upon treatment with 12.5 µM ErPC3 (A) A weak cleavage of caspase-3 and PARP was also observed when LNCaP cells ... Germany) Rabbit antibodies against PARP, caspase-3, Akt, phospho-Akt (Ser473), Bax, Mcl-1, and Bcl-xL were purchased from Cell Signaling (Frankfurt, Germany), the rabbit anti-Bak NT antibody was from ... ErPC3, as indicated (D-F) 48 h after treatment a WST-1 Assay was performed The absorption correlates with the number of viable cells and was normalized to that of untreated controls PC3 (A) and...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Effects of radiation therapy on tissue and serum concentrations of tumour associated trypsin inhibitor and their prognostic significance in rectal cancer patients" doc
... were analysed using a time-resolved immunofluorometric assay, with the MAb 6E8 as a capture antibody for TATI and a europium (Eu) labelled antibody 1 1B3 as a tracer [2,15] Fluorescence was measured ... s-TATI concentrations increased considerably after surgery for many of the short-term regimen treated patients, which supports the theory that TATI can behave as an acute phase reactant, as demonstrated ... demonstrate that concentrations of TATI in tumour tissue or serum are not affected by neoadjuvant radiotherapy in rectal cancer patients The finding of an association between both t-TATI and sTATI,...
Ngày tải lên: 09/08/2014, 09:21
Báo cáo y học: "Short- and long-term effects of anti-CD20 treatment on B cell ontogeny in bone marrow of patients with rheumatoid arthritis" ppsx
... rituximab-treated patients as compared with rituximab-naïve The absolute numbers of B cells in the rituximab-treated and rituximab-naïve patients are shown in Table The accumulation of immature subset ... Rituximab was provided intravenously in two doses of 1000 mg each on days and 15 The efficacy of rituximab treatment was assessed clinically by disease activity score (DAS) 28, a composite measure based ... in BM, and by an increase of immature (CD27-IgD) B cells (P = 0.01) The absolute numbers of B cells in the rituximab-treated and tituximab-naïve patients are shown in Table No correlation was...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Anti-inflammatory and arthritic effects of thiacremonone, a novel sulfurcompound isolated from garlic via inhibition of NF-κB" pptx
... perspective on garlic and cardiovascular disease J Nutr 2001, 131:977S-979S Tanaka S, Haruma K, Yoshihara M, Kajiyama G, Kira K, Amagase H, Chayama K: Aged garlic extract has potential suppressive ... Okamoto H, Iwamoto T, Kotake S, Momohara S, Yamanaka H, Kamatani N: Inhibition of NF-kappaB signaling by fenofibrate, a peroxisome proliferator-activated receptor-alpha ligand, presents a therapeutic ... NF- B was confirmed by competition assays as well as by super shift assays In the presence of a p50 antibody, the DNA-binding activities of NF B showed a super shift However, in the presence of a...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Chemokine receptor expression and functional effects of chemokines on B cells: implication in the pathogenesis of rheumatoid arthritis" ppt
... were analyzed with a FACSCalibur (BD Bioscience, San Jose, CA, USA) Migration assay Cell migration was assessed in 24-well chemotaxis chambers (6.5 mm diameter, μm pore polycarbonate transwell ... UK) was added and the B cells were incubated for 24 hours Afterward, the incorporated radioactivity was quantified After the 72-hour incubation, viabilities of the cells, determined by trypan blue ... were analyzed with a FACSCaliber Statistical analysis Paired t test was used to compare paired samples of CD27and CD27+ peripheral blood B cells, and peripheral blood and synovial B cells from the...
Ngày tải lên: 09/08/2014, 14:22