... such as roads, waterways, and fences placed diagonally, are generally perceived as more dynamic than horizontally placed ones: Tips for beginners Hold your camera at the main object's level Taking ... found that certain points in a picture's composition automatically attract the viewer's attention Similarly, many natural or man-made objects and scenes with certain proportions (whether by chance ... object is the task for a specialist Use a dark background for taking a picture of a light object, or, alternatively, a light background for doing so of a dark object Note though, that the absolutely...
Ngày tải lên: 27/10/2013, 23:15
... their own ideas, their information, their available knowledge and basing on that the learners can understand the lesson and practice using the language better 1.3 Summary This chapter has been concerned ... understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar Is there a story ... the material which you consider important rather than trivial Students will study and learn based on the questions you ask Do not mislead them by emphasizing less important material Phrase your...
Ngày tải lên: 27/12/2013, 20:26
Tài liệu Managing Your Suppliers as a Resource Introduction Several years ago, I visited Camco, GE''''s doc
... supplier management, using your suppliers as a resource, allows both companies to move past the traditional adversarial relationship toward a partnership with deep mutual value creation Innovative ... management In Japan, supplier management is viewed as an essential management function Suppliers are viewed as the "hidden factory." This perspective is largely missing in all too many companies ... (1) a diagram of the information and product flow at each channel stage, including handling, storage, moving, processing, etc.; (2) a quantitative analysis, or representative model, of product accumulation...
Ngày tải lên: 26/01/2014, 03:20
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively...
Ngày tải lên: 29/01/2014, 10:33
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx
... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... relations, 12 classes: evaluation on Levi-214 dataset Shown are micro-averaged accuracy and coverage in %s, followed by average number of features (ANF) and average sum of feature frequencies (ASF) ... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve...
Ngày tải lên: 08/03/2014, 01:20
Evaluating the Executive Director Your Role As a Board Member doc
... that the board has any power at all Choose an Approach To some extent, you are always evaluating the executive director, via observation at formal and informal meetings, in conversations you have ... Ensure that the board, as a group, has stated the organization’s shortand long-term objectives with enough clarity that the executive—the board’s employee—can reasonably be held accountable for accomplishing ... respondents are asked to rank various categories on a five-point scale Open-ended questions may also be included Surveys have several advantages They can be automated via online survey tools such as Survey...
Ngày tải lên: 24/03/2014, 01:20
USING YOUR BRAIN FOR A CHANGE
... a new feeling about the event as an observer rather than as a participant It's a very effective way to change your response The ideal situation is to recall all your pleasant memories associated, ... to that memory, and be sure that you see what you saw at the time that pleasant event happened You can close your eyes if that makes it easier to As you look at that pleasant memory, I want ... that you can learn things exquisitely and rapidly The bad side is that you can learn garbage just as easily as you can learn useful things How many of you are haunted by thoughts? You say to yourself,...
Ngày tải lên: 07/04/2014, 00:21
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... draft training program was revised and finalised accordingly GAP Workshop in Binh Thuan (21-22/7/2008) Baseline survey Farmers’ opinion towards the cashew IPM program using weaver ants as a major ... of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly...
Ngày tải lên: 21/06/2014, 05:20
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data obtained ... that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly reduced Seven days later after this baiting, weaver ant ... black ant, Tapinoma melanocephalum, that was abundant on the remaining trees of the plot Baiting of competitive ant species Ant baits (Amdro and Campaign ant bait) brought from Australia were tried...
Ngày tải lên: 21/06/2014, 06:20
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
... least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that farmers ... play a very important part in cashew production Table shows that 8% of cashew orchards are managed by women, 70% are jointly managed by men and women and 22% by men The women have had an average ... holders, having about of orchards with an average tree age ranging from years (from grafted materials) to 12 years (from seeds) Cashew apples were generally not used Cashew nut yield was about 1400...
Ngày tải lên: 21/06/2014, 06:20
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals ... strategy (weaver ants, pruning and light-trapping) to manage the branch borer that has been one of the major concerns by all cashew growers in Vietnam He has already passed this knowledge to IAS project ... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
... ghost ant baiting, weaver ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much higher and the yield was much ... the transplants from the farmer’s plot, almost every tree had weaver ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephalum), small sized crematogaster ants (Crematogaster ... each of which was divided into two plots: a farmer’s plot that was managed with chemical insecticides, and an IPM plot that was managed by using the weaver ants (Oecophylla smaragdina) The field...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
... their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers never knew about their ... examinations Each of them was awarded a graduation certificate in the cashew IPM training Now, we have 112 TOT cashew IPM trainers, and they are distributed in ten cashew growing provinces (Table ... Cashew pest control and production Mr LP Lan IAS Plant protection X X Mr NT Binh IAS Cashew breeding X X and cultivation Mr DV Tu IAS Cashew cultivation X X Mr DD Hien IAS Fertilizer application...
Ngày tải lên: 21/06/2014, 06:20
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
... lphlan@yahoo.com 2 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased since 2002, ... has showed that using weaver ants as a major component to manage cashew insect pests is effective and profitable Most FFS farmers commented that this IPM program would achieve sustainable cashew ... integrated cashew improvement (ICI) program using weaver ants as a major component - Manual for ICI program trainers and extension officers in Vietnam” has been developed The manual includes • cashew...
Ngày tải lên: 21/06/2014, 06:20
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
... enemies and cashew orchard management skills are ready for the preparation of cashew IPM posters In our field surveys, we found that cashew trees with abundant crematogaster ants were much less damaged ... Data analyses and writing up Cashew trees have been either in dormancy or in monsoon leaf flush since the project started Baseline data of the insect pest assemblage and their damage were obtained ... provinces with a standard questionnaire The survey concentrated on current cashew husbandry practices, assessment of cashew production, labour use and costs, pest and disease practices and assessment...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo nghiên cứu khoa học " INTEGRATED PEST MANAGEMENT USING WEAVER ANTS AS A MAJOR COMPONENT FOR CASHEW " doc
... Christian, Renkang Peng, La Pham Lan & Nguyen Thanh Binh Introduction Cashew (Anacardium occidentale) is an important crop in Vietnam, and the government has designated cashew development as a national ... reduction of natural enemies and pollinators The suggestion of using a biological agent as weaver ant (Oecophylla smaragdina) instead of insecticides is not new but has potential as a control measure ... program using weaver ants as a major component Manual for ICI program trainers and extension officers in Vietnam” As planned, the manual includes up-to-date information about cashew botany, breeding,...
Ngày tải lên: 22/06/2014, 12:20
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using ... scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and independent ... CA: Caudal artery; CV: Caudal vein; DA: Dorsal aorta; DLAV: Dorsal longitudinal anastomotic vessel; PCV: Posterior (caudal) cardinal vein; Se: Intersegmental vessel B-E: No significant alteration...
Ngày tải lên: 15/05/2015, 00:37
BÀI LUẬN TIẾNG ANH HAY nuclear energy write about the pros and cons of using nuclear energy as a energy source
Ngày tải lên: 20/08/2015, 00:37
Experimental investigation on a flat plate solar collector using al2o3 nanofluid as a heat transfer agent
... karbala University E-mail address: abbasmarem@yahoo.com Mohammed Hassan Abbod Ass Prof Dr, Department of Mechanical Engineering, karbala University E-mail address: Malmussawie@yahoo.com Sura Qahtan ... GoharshadiE.K., Ahmadzadeh H., Samiee S., and Hadadian M Nanofluids for Heat Transfer Enhancement -A Review, Phys Chem Res., 2013,1, 1, 1-33 Masuda H., Ebata A. , Teramae K., Hishinuma N Alteration of thermal ... insulation edges insulation Remarks Gross area=0.6656 Material: black painted stainless steel Material: window glass Material: copper Number of tubes: six Material: glass wool Material: glass...
Ngày tải lên: 09/09/2015, 10:06
Creating Your CV as a self Marketing Tool
... States and Canada it is generally called a Resume, but the contents remain the same and need to capture a number of key areas, including: • A Personal Proile Statement • Roles undertaken, clearly ... naturally born sales persons and on many occasions feel embarrassed and uncomfortable about talking about themselves he book will show how to overcome these as far as capturing information on paper is ... presented in a clear and concise manner with the initial objective of creating impact and a professional impression to the reader Always be truthful about what you are saying about yourself, as you...
Ngày tải lên: 09/08/2016, 13:00