using text as a model

... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using ... Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and independent organism retaining ... using zebrafish embryos among scientists (Figure 1. 2A) as well as legislators: The International Organization for Standardization (ISO) has standardized the zebrafish embryo test for waste water...

Ngày tải lên: 15/05/2015, 00:37

... convenient Slackware setup program to format and setup the root and swap partitions identically to the first machine Specifically, we made the root partition and the swap partition the same partition ... point-to-point daemon, supports "proxy arp," which lets you avoid wasting a network on the point-to-point link Basically, proxy arp makes your remote machine’s point-to-point interface appear as if it ... complications of ISDN or geographic distance We connected a hub and a PC to the cloned machine to simulate conditions at the remote site This was where routed caused everything to fall apart As soon...

Ngày tải lên: 18/10/2013, 17:15

... nx is unaffected by recombination of free electrons and ions in ˙ the case that Pg Ϸ Px, even if fast In the case of asymmetric recombination, a fast initial transient is expected, whereas the ... exponential with the same decay time as in the low power limit To understand this remarkably simple result, we analyze the dynamics after the pump pulse has passed, that is, the relaxation and the ... We have -1 / T (a. u.) Lyman transitions 1s (A1 ) np0, npϮ between 34 and 45 meV are apparent No pump-probe effect was seen when the laser was not resonant The relaxation lifetime of the 2p0 state...

Ngày tải lên: 16/03/2014, 15:30

... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have ... engraftment was achieved using both methods as shown by expression of human CD45 3–6 months post-transplantation Additionally, secondary engraftment was achieved following intravenous transplantation...

Ngày tải lên: 22/03/2014, 17:20

... concentration of Na+ activates pyruvate kinase without K+ [27] The reaction was initiated by an addition of lg enzyme K+-activated phosphatase activity was determined as K+-dependent pNPPase activity ... Yokoyama, T., Kaya, S., Abe, K., Taniguchi, K., Katoh, T., Ê Yazawa, M., Hayashi, Y & Mardh, S (1999) Acid-labile ATP and/or ADP/Pi binding to the tetraprotomeric form of Na/KATPase accompanying ... mixer and subjected to ultrasonication RESULTS Effects of pressure on Na+/K+-ATPase, Na+-dependent ATPase and K+-activated phosphatase activities It could be con®rmed that the Na+/K+-ATPase activity,...

Ngày tải lên: 24/03/2014, 00:21

... assessing the translational potential of ideas that are still in the percolation phase The NIH intramural program is an ideal test site for such new translational research approaches, percubator ... MRE-B is a translational researcher who has participated in many laboratory and clinical research studies, as well as several successful biotechnology company start-ups, both privately and in his ... intramural program is often close to impermeable In contrast, universities and many research institutions contain a semi-permeable barrier that allows academic investigators to work in both arenas,...

Ngày tải lên: 18/06/2014, 19:20

... assessing the translational potential of ideas that are still in the percolation phase The NIH intramural program is an ideal test site for such new translational research approaches, percubator ... MRE-B is a translational researcher who has participated in many laboratory and clinical research studies, as well as several successful biotechnology company start-ups, both privately and in his ... intramural program is often close to impermeable In contrast, universities and many research institutions contain a semi-permeable barrier that allows academic investigators to work in both arenas,...

Ngày tải lên: 20/06/2014, 03:20

... (Figure 4a) and ICSNPs (Figure 4b) as measured by DLS The average size of CSNPs as determined by DLS was ca 21 nm On the other Figure XRD patterns of (a) mercaptoacetic acid-coated CSNPs and (b) bare ... analysis (ESCA, ESCA LAB VIG microtech, Mt 500/1, etc., East Grinstead, UK) with MgK a at 1, 253.6 eV and 150 W of power at the anode A survey scan spectrum was taken, and the surface elemental ... triplicate, and the results are expressed as mean ± standard deviation Student’s t test was employed to assess statistical significant difference of the results Results and discussion Characterization...

Ngày tải lên: 20/06/2014, 22:20

... Togawa, Shunsuke Koresawa, Sumire Hasegawa, Yoshinobu Takemoto, Masahiro Yoshimoto, Kazuyuki Mitani, Kosuke Miyashima, Masakiyo Mannoji, Takashi Sugihara, Nobumasa Inoue, Masaoo Shimoda, Akio Kanzaki, ... Mayumi Kaku, Masami Uno (Takezono), Kenichiro Yata, Hidekazu Nakanishi, Yoshimasa Suetsugu, Makoto Mikami, Takayuki Tsujioka, and Shinichiro Suemori, Ms Mayumi Aizawa (Takahara), Chie Kawasaki ... T., Kanzaki, A. , Kaku, M., Yawata, A. , Takezono, M., Okamoto, N., Wada, H., Sugihara, T., Yamada, O., Katayama, Y., Nagata, N., Yawata, Y (1998) Homozygous missense mutation (band Fukuoka: G130R):...

Ngày tải lên: 29/06/2014, 11:20

... chromosomes separated into two classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and usually classified ... high, saturated genetic maps would be necessary to have very close markers available each time in order to permit a molecular marker-assisted selection The current genetic maps contain around ... structure and functions of avian micro- and macrochromosomes, Russ J Genet 32 (1996) 517-527 [69] Rodionov A. V., Myakoshina Y.U., Chelysheva L .A. , Solovei LV., Gaginskaya E.P., Chiasmata on lampbrush...

Ngày tải lên: 09/08/2014, 18:21

... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... University of California Santa Cruz [32] and NCBI [33] genome browsers for public queries as soon as it is available and passes contamination analyses, and relevant announcements and links will ... comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation of ancestral gene family...

Ngày tải lên: 09/08/2014, 23:20

... treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT ... cancer is associated with the same survival benefit as adjuvant chemotherapy and offers the advantage of an increased likelihood of breast conservation Many drug regimens have been used for a ... mammary cancer J Vet Med A 2001, 48:85-96 Yamashita A, Maruo K, Suzuki K, Shirota K, Kobayashi K, Hioki K: Experimental chemotherapy against canine mammary cancer xenograft in SCID mice and its...

Ngày tải lên: 12/08/2014, 18:22

... 90 Mashima R, Saeki K, Aki D, Minoda Y, Takaki H, Sanada T, Kobayashi T, Aburatani H, Yamanashi Y, Yoshimura A: FLN29, a novel interferon- and LPS-inducible gene acting as a negative regulator ... signaling J Biol Chem 2005, 280:41289-41297 91 Shinohara H, Inoue A, Toyama-Sorimachi N, Nagai Y, Yasuda T, Suzuki H, Horai R, Iwakura Y, Yamamoto T, Karasuyama H, et al.: Dok-1 and Dok-2 are ... Ishii KJ, Kobiyama K, Kojima Y, Coban C, Sasaki S, Ishii N, Klinman DM, Okuda K, Akira S, et al.: TRAF4 acts as a silencer in TLR-mediated signaling through the association with TRAF6 and TRIF Eur...

Ngày tải lên: 13/08/2014, 03:20

... normal, differentiating rat osteoblasts J Cell Physiol 1999, 181:479-488 129 Yamashita T, Asano K, Takahashi N, Akatsu T, Udagawa N, Sasaki T, Martin TJ, Suda T: Cloning of an osteoblastic cell line ... 102:274-282 126 Nakashima T, Sasaki H, Tsuboi M, Kawakami A, Fujiyama K, Kiriyama T, Eguchi K, Ichikawa M, Nagataki S: Inhibitory effect of glucocorticoid for osteoblast apoptosis induced by activated peripheral ... hyperlipidemias [115] Jones has described the triad of intraosseous fat embolism, intravascular coagulation and osteonecrosis in man He has suggested that the mediatory pathway of fat emboli, hypercoagulability,...

Ngày tải lên: 13/08/2014, 23:20

... (where applicable) and N-pyroglutamate were allowed as variable modifications Due to the high mass accuracy, the 99% significance threshold (p < 0.01) in the yeast database search was a Mascot ... sequence database This database was complemented with frequently observed contaminants (porcine trypsin, achromobacter lyticus lysyl endopeptidase and human keratins) A 'decoy database' was prepared ... sequence reversing each entry and appending this database to the forward database Search parameters specified a MS tolerance of 10 ppm (see above) and an MS/MS tolerance at 0.5 Da and either full...

Ngày tải lên: 14/08/2014, 16:21

... for Languages EFL English as a Foreign Language ESL English as a Second Language FLF Foreign Language Faculty HPU2 Hanoi Pedagogical UniversityNo2 ULIS University of Languages and International ... Language Faculty, Hanoi Pedagogical University No Several papers and articles have investigated portfolios from the angle of an alternative assessment tool for traditional assessment Unfortunately, ... portfolio-based assessment began to attract attention around the mid-1980s as a reaction against the psychometric climate prevailing educational standards This atmosphere led to intense pressure to place...

Ngày tải lên: 16/07/2015, 07:45

... et al., 1990) Different mammalian Rho GTPases are at least 40% identical to each other at the amino-acid level, whereas they are approximately 25% identical to Ras To date, only Rho, Rac, and ... metabolism, may generate ATP which in turn closes ATP-sensitive potassium (KATP) channels, leading to the membrane depolarization and Ca2+ entry (McClenaghan et al., 1996) Basic amino acids such as arginine ... effectors act as regulators of actin polymerization The p21activated kinase (PAK) that is activated by binding to active Rac or Cdc42, serves as a downstream effector for actin reorganization (Manser...

Ngày tải lên: 16/09/2015, 17:11

... Using Portfolios as a Means of Evaluation in an English Foreign Language Translation Course, a Case Study at the Faculty of Foreign Languages, Hanoi Pedagogical University N02” (Graduation paper ... in more foreign language classes Based on the results of the survey, it is clear that portfolio has a great of benefits; however both teachers and students also face some challenges when implementing ... portfolio as well as ways to improve students’ self-learning portfolio The participants of the survey questionnaires are 44 third-year English-major students of the Faculty of Foreign Languages, Hanoi...

Ngày tải lên: 30/11/2015, 09:14

Ngày tải lên: 29/08/2016, 18:18