Ngày tải lên: 12/08/2014, 18:22
Ngày tải lên: 18/12/2013, 10:07
the stonehenge people an exploration of life in neolithic britain, 4700-2000 bc
... island people borrowed farming practices piecemeal from other cultures, combining and adapting them to suit the varying conditions of the island. Local mesolithic practices were incorporated into ... traditional view of neolithic farming as a whole; small, primitive groups scratching a precarious living in clearings in a vast primeval forest. The land clearance in the lowlands of Cumbria involved ... became evident. A combination of deforestation, farming practices and climatic conditions caused the soils to deteriorate physically and chemically. Over large areas, the loss of soil fertility and an increase in...
Ngày tải lên: 31/05/2014, 02:00
An Analysis of Opportunities in the Wind Power Value ChainEA IEnergy Alternatives pdf
... construction contractors provide engineering, procurement and construction services, including civil works, laying cables for electrical infrastructure, and installing wind turbines. Over the past decade, ... adjusting and risk engineering wind power projects provide insurance services. These include: q Insurance Cost Estimating q Insurance Brokerage/ Risk Management q Contract Review/ Analysis/ Document ... periods for installing wind turbines, and the increasing reliability and performance of wind energy machines have made wind power a favored choice for capacity addition in India. Currently, India...
Ngày tải lên: 28/06/2014, 14:20
Báo cáo y học: " Epitope spreading in animal models: array of hope in rheumatoid arthritis and multiple sclerosis" pot
... cyclic citrullinated peptides (CCPs) both in diagnosing and predicting disease. The specific target antigens include citrullinated fibrinogen, citrullinated vimentin, citrullinated collagen type ... use of an array in animal models may produce a hint of what happens in human disease. A more complete picture will be obtained from animals transgenic for human MHC, immunised with known human autoantigens. Epitope ... was provided by anti-citrulline immunoblotting, which demon- strated an increase of citrullinated proteins in both inflamed synovium and brain tissue. Other interpretations, however, include the possibility...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học:" Using Chinese Version of MYMOP in Chinese Medicine Evaluation: Validity, Responsiveness and Minimally Important Change" ppt
Ngày tải lên: 12/08/2014, 01:21
Báo cáo sinh học: "Selection on testis size as an indicator of maturity in growing animals. I Direct and correlated responses in growth" pdf
Ngày tải lên: 14/08/2014, 20:20
Báo cáo sinh học: "Selection on testis size as an indicator of maturity in growing animals. II Correlated responses in reproductive rate" pot
Ngày tải lên: 14/08/2014, 20:20
Sustainability of an energy conversion system in Canada involving large-scale integrated hydrogen production using solid fuels
Ngày tải lên: 05/09/2013, 14:58
An analysis of errors commonly committed by high school students in using english questions
Ngày tải lên: 18/12/2013, 10:04
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx
... or by any means, without permission in writing from the publisher. Engineering Mechanics - Statics Chapter 1 Problem 1-1 Represent each of the following combinations of units in the correct SI ... reproduced, in any form or by any means, without permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Problem 2-24 Resolve the force F into components acting along ... publisher. Engineering Mechanics - Statics Chapter 1 b() S 2 8.368 kN= c( ) S 3 893g= Problem 1-6 Represent each of the following to three significant figures and express each answer in SI units using an appropriate...
Ngày tải lên: 17/02/2014, 14:20
Báo cáo khoa học: The multifarious short-term regulation of ammonium assimilation of Escherichia coli: dissection using an in silico replica pdf
... regulation of ammonium assimilation of Escherichia coli: dissection using an in silico replica Frank J. Bruggeman 1 , Fred C. Boogerd 1 and Hans V. Westerhoff 1,2,3 1 Molecular Cell Physiology, Institute ... silicon cell models already a chal- lenging and productive scienti c endeavour, because it may lead to the discovery of new principles and mech- anisms [48,49]. Because such models are an exact ... activation of transcription. Proc Natl Acad Sci USA 89, 5088–5092. 43 Schutt H & Holzer H (1972) Biological function of the ammonia-induced inactivation of glutamine synthetase in Escherichia...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx
... to c reate the exercise trajectories and were typically performed on a single plane. Clinicians used their clinical judgement to tailor practice sessions and to c hoose exercises accord- ing ... the participants into one of two groups using a random number table. A research technican from the University of Guelph collected the biomechanical and progress data from the robotic system at baseline ... online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx
... 60.0 CS TGGAACCATCATCACCCGAACCCAAGAGGCGGAGGGTCGGTGACGTGGAA CCGTCACGCAAACCCAAGAG CLU Hs.75106 70 1676 903 82.4 60.0 CS TTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAG CCCCTGAACTTCCACGCCA MTA2 ... 52.8 CS ATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGA CTAACCCTGTTCCCAGAGCC T CFL1 Hs.2430 70 1324 153 76.5 46.2 CS CCCCGAGCCTTGCGCCAGAAAATTGTCATTAAATGAAGAGATGTCTAGTCC TCAGAAACTTCTTTCCTGC H3F3A ... CCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAA GTACTCCGTGTGGATCGGCG c- yes.70 mer Hs.194148 70 4343 1249 96.7 62.9 PE CTCGGCTCACTGCAAGCTCTGCCTCCCAGGTTCACACCATTCTCCTGCCTC AGCCTCCCGAGTAGCTGGG c- yes.2 Hs.194148...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo toán học: " Enhancement of the photoelectric performance of dye-sensitized solar cells by using Ag-doped TiO2 nanofiber in TiO2 nanoparticle film as an electrode" pot
... looking at the improved connection of TiO 2 nanoparticles or the Ag effect of the electrons during transition. The increased electron lifetime and the reduction of the electron transit time can ... time can explain the increment of J sc by the addition of ATN. Conclusions In conclusion, TN and ATN were added into the TiO 2 film of DSSCs. An enhanced η of 129% was achieved from ... Authors' contributions EMJ participated in the fabrication of DSSCs and in the analysis of photocurrent-voltage characteristics. XGZ was involved in the FE-SEM, EDX, and IMVS analyses of TiO2...
Ngày tải lên: 20/06/2014, 20:20
Study on the propagation of inlet flow distortion in axial compressor using an integral method_1 ppt
... to analyze the propagation of inlet distortion in axial compressor. Finally, the compressor critical performance and critical characteristic are also discussed. 1.2 Theoretical Formulation Consider ... useful information about the per- formance of the axial compressor with inlet distortion, which is meaningful to engi- neering application in the design and analysis of turbomachinery. In this chapter, ... achieve a complete success in calculating the distorted performance and distortion attenuation of an axial compressor even though the use of high speed computers has greatly improved the accuracy...
Ngày tải lên: 21/06/2014, 21:20
Bạn có muốn tìm thêm với từ khóa: