using a linux box as a firewall

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

... Eurafrica, Austafrica, Asia, America, Oceanica. Causes and consequences of the migrations of races and nations. a. The Eurafrican Race.—Types of the white race. Its first home. Early migrations. ... of languages. Universal alphabets. Logical relations of the parts of speech. The vocabulary and the grammar of languages. Distinctions between languages and dialects. Mixed languages and jargons. ... Races. Theories of monogenism and polygenism. Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth. Eurafrica,...

Ngày tải lên: 13/02/2014, 05:20

28 666 0
Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx

Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx

... addition of a small value is an easy and effective way to avoid the unsatisfactory case, as shown in (Yarowsky, 1994). {est(wl, ), ea(w , e#), ã ã ã, e e#)), and set the word wk as the answer ... increases. Our method has an advantage that the size of DL1 is smaller. The size of the decision list has no relation to the precision and the recall, but a small decision list has advantages ... problem by using various 1 '~' ~.,~. and '~.~ m~,' have a same phone 'i-sift'. The meaning of '~,' is a general will, and the meaning of '~:~'.~.,,...

Ngày tải lên: 22/02/2014, 03:20

8 588 0
Public management as a social science or a business subject in a   luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán

Public management as a social science or a business subject in a luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán

... had increased; water was scarce and wasted through poor management of sanitation and infrastructure; average life expectancy was declining; education outcomes are poor; safety and security was ... seasons and is a silver medalist for the Comrades marathon and Two Oceans ultra marathon. He has completed eleven Two Oceans ultra marathons, ten Two Oceans half marathons and sixteen Cape Argus ... management academic programme, which at that time was the National Diploma and Advanced Diploma. The Public Management academic programme now includes the postgraduate qualifications of Master’s...

Ngày tải lên: 02/04/2014, 00:13

25 499 0
Tài liệu Using a Web Service as a Data Source pdf

Tài liệu Using a Web Service as a Data Source pdf

... orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.FillSchema(orderDetailTable, SchemaType.Source); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable); // Create a relation ... DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet. da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); ... Northwind as a local class or as a web services class. [ Team LiB ] using System.Data; // Table name constants private const String ORDERS_TABLE= "Orders"; // . . . // Create...

Ngày tải lên: 21/01/2014, 11:20

4 369 0
Tài liệu Báo cáo khoa học: "Using an Annotated Corpus as a Stochastic Grammar" ppt

Tài liệu Báo cáo khoa học: "Using an Annotated Corpus as a Stochastic Grammar" ppt

... A may be 40 M. Marcus, 1991. "Very Large Annotated Database of America~ English". DARPA Speech and Naawal Language Workshop, ~ Grove, Morgan Kaufmarm. F. Pereira and Y. Schabes, ... trivial part of a natural language, .almost every input string of reasonable length gets an unmanageably large number of different analyses. Since most of these analyses are not perceived as ... probability can be computed as the product of the 39 Using an Annotated Corpus as a Stochastic Grammar Rens Bod Department of Computational Linguistics University of Amsterdam Spuistraat...

Ngày tải lên: 22/02/2014, 10:20

8 393 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... those measures that are being used inthetarget areas as well as foreigncountries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of themareintroduced as follows. 3.6.1.Structuralmeasures A1 :Polyculture In ... In doingso,theconsensusontheproblemsand theirsolutionscanbereached.However,itis notedthatMCAissubjectiveinitsnature.In case the  quantitative data are available, quantitative analysis (i.e. numerical modelling) ... in QuangTriProvince.TheapplicationofMCA includesdeterminingtheemergingproblems, objectivesand requirementsofrelatedfactors, as well as thealternativesthathavebeenused in the study area. From that it suggests the measurestosolvetheproblemsandapplythe MCAapproachforselectingthemostsuitable options. The...

Ngày tải lên: 22/03/2014, 12:20

13 488 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

... RevNES (5Â-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3Â and 5Â-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3Â) were annealed and inserted into the BglII and HindIII sites ... and 5Â-AUAAGUAAUUUCUACGACG dTdT-3Â; Nup358, 5Â-CCAGUCACUUACAAUUAAAd TdT-3Â and 5Â-UUUAAUUGUAAGUGACUGGdTdT-3Â (siNup358-1), 5Â-UGAAGCACAUGCUAUAAAAdTdT-3Â and 5Â-UUUUAUAGCAUGUGCUUCAdTdT-3Â (siNup- 358-2)]. ... Differential localization of HDAC4 orchestrates muscle differentiation. Nucleic Acids Res 29, 3439–3447. 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamik- awa Y, Oe S, Asally M, Kamachi Y,...

Ngày tải lên: 06/03/2014, 01:20

12 454 0
Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot

Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot

... any information associated with a name, for instance, an activity value, is viewable from any spaces in which the name exists. This means that any interpreted meaning associated with a name ... grammar can be affected in isolation from other aspects of language function. (Cf Studies of agrammatic and Broca's aphasia as described in Goodenough, Zurif, and Weintraub, 1977; Goodglass, ... one can view a grammar as an integrated part of a neuraIly- motivated processing model that is psychologically valid. ~uitable constraints on grammatical form that are relevant for using...

Ngày tải lên: 08/03/2014, 18:20

9 379 0
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot

Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot

... the performance of rosetta using multiple sequence align- ment information and global measures of hydrophobic core formation. Proteins 43, 1–11. 11 Murata T, Fushinobu S, Nakajima M, Asami O, Sassa T, ... Free induction decay values with on- and off-resonance protein saturation were recorded in alternative fashion. Subtraction of the 1D STD spectra was achieved via phase cycling. Pro- tein resonance was suppressed ... Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand Takashi Murata 1,3 , Hikaru Hemmi 1 , Shugo Nakamura 2 , Kentaro Shimizu 2 ,...

Ngày tải lên: 16/03/2014, 23:20

11 565 0
South Asia as a Tourism Orbit Formulating a Regional Tourism Strategy

South Asia as a Tourism Orbit Formulating a Regional Tourism Strategy

... beaches (Coxes Bazaar), and mangrove areas (Sunderbans) are located in the region. Its biodiversity is unmatched (Sinharaja, Chitwan). Home to marvels such as the Taj Mahal, Ajanta, Sigiriya, ... South-East Asia, North Africa (both at +9%) and Central and Eastern Europe (+8%) topped the ranking. The Americas (+4%) saw an increase of 6 million arrivals, reaching 162 million in total. Africa ... South Asian Association for Regional Cooperation (SAARC) has also identified tourism as a key area of cooperation among members. According to SARC official website, “The importance of tourism had...

Ngày tải lên: 19/03/2014, 00:20

12 481 0
English as a Second Language Learners: A Guide for ESL Specialists doc

English as a Second Language Learners: A Guide for ESL Specialists doc

... tograduate from a Canadian high school and go on to graduate from a Canadian high school and go on tograduate from a Canadian high school and go on to graduate from a Canadian high school and ... Grade 10 class. His parents want him tobeen placed in a Grade 10 class. His parents want him to been placed in a Grade 10 class. His parents want him to graduate from a Canadian high school and go ... has Byung Soo is a fee-paying student from Korea, who has been placed in a Grade 10 class. His parents want him tobeen placed in a Grade 10 class. His parents want him to been placed in a Grade...

Ngày tải lên: 02/04/2014, 05:20

62 780 1
báo cáo khoa học: "Ectopic thymoma presenting as a giant intrathoracic tumor: A case report" ppt

báo cáo khoa học: "Ectopic thymoma presenting as a giant intrathoracic tumor: A case report" ppt

... Tokusashi 2 , Naoyuki Miyokawa 2 and Tadahiro Sasajima 1 Abstract Ectopic thymoma rarely presents as an intrathoracic tumor. We report a case of ectopic thymoma presenting as a giant right intrathoracic ... 9:66 http://www.wjso.com/content/9/1/66 Page 3 of 4 CAS E REP O R T Open Access Ectopic thymoma presenting as a giant intrathoracic tumor: A case report Masahiro Kitada 1* , Kazuhiro Sato 1 , Yoshinari Matsuda 1 , Satoshi Hayashi 1 , ... 8 cm and weighing 430 g, * Correspondence: k1111@asahikawa-med.ac.jp 1 Department of Surgery, Asahikawa Medical University, Midorigaoka-Higashi 2-1-1-1, Asahikawa, Hokkaido 078-8510, Japan Full...

Ngày tải lên: 09/08/2014, 02:20

4 315 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

... the anti-SmD3 peptide (SMP) assayAssay performance characteristics of the anti-SmD3 peptide (SMP) assay. (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating ... pep- tide-based assay (99.8%; data not shown). Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays. ... peptide was assessed by mass spectrometry and analytical high-performance liquid chromatography. The molecular mass was found to be 1708.1 Da (average; monoisotopic mass 1706.9), and a purity...

Ngày tải lên: 09/08/2014, 06:22

11 593 0
Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx

Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx

... Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal Actions of Parasporin-2, an Anti-tumor Crystal Toxin from Bacillus ... Biophys Acta 2001, 1547:57-63. 22. Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal actions of parasporin-2, an anti-tumor ... bovine serum albumin (BSA) as standard. Separation of Bt18 parasporal protein The trypsin activated parasporal protein was separated using Mono Q anion exchange column attached to a HPLC system...

Ngày tải lên: 10/08/2014, 05:21

11 366 0
w